GtRNAdb

tRNAscan-SE Analysis of Aeropyrum pernix

>> Main Overview
>> tRNAs by Isotype
>> tRNAs by Locus
>> Secondary Structures
>> tRNA Alignments
>> FASTA Seqs
>> Run Options/Stats
>> Analysis Notes
>> UCSC Genome Browser
>> Genome DB
>> Genome Seq
Predicted tRNA Secondary Structures


Click on "View tRNA" buttons to view 2-D tRNA structures

Cove-predicted tRNA secondary structures rendered by NAVIEW (c) 1988 Robert E. Bruccoleri


chr.trna3 (1-77)	Length: 77 bp
Type: Ala	Anticodon: CGC at 35-37 (35-37)	Score: 93.45
Seq: GGGCCGGTAGCTCAGCCtGGAAGAGCGCCGCCCTCGCACGGCGGAGGcCCCGGGTTCAAATCCCGGCCGGTCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna39 (1-77)	Length: 77 bp
Type: Ala	Anticodon: GGC at 35-37 (35-37)	Score: 88.60
Seq: GGGCCGGTAGCTCAGCCtGGAAGAGCGCCCGGTTGGCATCCGGGAGGcCCCGGGTTCAAATCCCGGCCGGTCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna27 (1-77)	Length: 77 bp
Type: Ala	Anticodon: TGC at 35-37 (35-37)	Score: 93.25
Seq: GGGCCGGTAGCTCAGCCtGGAAGAGCGCCCGGCTTGCACCCGGGAGGcCCCGGGTTCAAATCCCGGCCGGTCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna1 (1-78)	Length: 78 bp
Type: Arg	Anticodon: CCG at 36-38 (36-38)	Score: 92.70
Seq: GGGCCCGTAGCTCAGCCaGGAtAGAGCGCCGGCCTCCGGAGCCGGAGGtCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna26 (1-78)	Length: 78 bp
Type: Arg	Anticodon: CCT at 36-38 (36-38)	Score: 91.62
Seq: GGGCCCGTAGCTCAGCCaGGAtAGAGCGCCGGCCTCCTAAGCCGGTGGtCGGGGGTTCAAATCCCCCCGGGCCCGCCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna9 (1-79)	Length: 79 bp
Type: Arg	Anticodon: GCG at 37-39 (37-39)	Score: 92.86
Seq: GGGCCCGTAGCTCAGCCaGGAccAGAGCGCCGGCCTGCGGAGCCGGAGGtCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna17 (1-79)	Length: 79 bp
Type: Arg	Anticodon: TCG at 37-39 (37-39)	Score: 92.38
Seq: GGGCCCGTAGCTCAGCCaGGAccAGAGCGCCGGCCTTCGGAGCCGGCGGtCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna12 (1-122)	Length: 122 bp
Type: Arg	Anticodon: TCT at 36-38 (36-38)	Score: 82.42
Possible intron: 40-83 (40-83)
Seq: GGGCCCGTAGCTCAGCCaGGAcAGAGCGCCGGCCTTCTAagcggggccgggaggcctcggccctacctcggctgcgcggggacAGCCGGTGGtCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>...................................................<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna41 (1-77)	Length: 77 bp
Type: Asn	Anticodon: GTT at 35-37 (35-37)	Score: 86.11
Seq: GCCGGGGTAGCTCAGCTaGGTAGAGCGCCGGGCTGTTAACCCGGTGGtCGGGGGTTCAAGTCCCCTCCCCGGCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna4 (1-199)	Length: 199 bp
Type: Asp	Anticodon: GTC at 37-39 (37-39)	Score: 54.79
Possible intron: 41-161 (41-161)
Seq: GCCGCGGTAGTATAGCCtGGActAGTATGCGGGCCTGTCAagggccccgcctccgccccaccctcattctactacacgcttatcaggataaacagccgggcaaacgtttttaaccccgccgaaattcatactcttcccggggcggaggcgggcctgcggagAGCCCGTGACCCGGGTTCAAATCCCGGCCGCGGCGCCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>................................................................................................................................<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna23 (1-96)	Length: 96 bp
Type: Cys	Anticodon: GCA at 35-37 (35-37)	Score: 65.01
Possible intron: 39-56 (39-56)
Seq: GCCGGGGTGGCCGAGCGGTctAAGGCGGCGGGCTGCAGaggacctggcccgtagagACCCGTTAGttCCCGGGTTCGAATCCCGGCCCCGGCTCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.........................<<<<<......>>>>>.......<<<<<<<<<<<<....
                    
chr.trna20 (1-76)	Length: 76 bp
Type: Gln	Anticodon: CTG at 35-37 (35-37)	Score: 70.54
Seq: AGCCGGGTCGTCTAGCGGCccAGGATGCGGGGCTCTGGCCCCCGTGACCGGGGTTCGAATCCCCGCCCGGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna33 (1-76)	Length: 76 bp
Type: Gln	Anticodon: TTG at 35-37 (35-37)	Score: 71.26
Seq: AGCCGGGTCGTCTAGCGGCccAGGATGCGGGGTTTTGGCCCCCGTGACCCGGGTTCGAATCCCGGCCCGGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna14 (1-78)	Length: 78 bp
Type: Glu	Anticodon: CTC at 37-39 (37-39)	Score: 84.08
Seq: GCCGCGGTAGTATAGCCcGGCccAGTATGCGGGCCTCTCGAGCCCGTGACCCGGGTTCAAATCCCGGCCGCGGCACCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna24 (1-78)	Length: 78 bp
Type: Glu	Anticodon: TTC at 37-39 (37-39)	Score: 84.64
Seq: GCCGCGGTAGTATAGCCcGGCccAGTATGCGGGCCTTTCGAGCCCGTGACCCGGGTTCAAATCCCGGCCGCGGCACCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna32 (1-79)	Length: 79 bp
Type: Gly	Anticodon: CCC at 37-39 (37-39)	Score: 90.77
Seq: GCGGCCGTCGTCTAGCCtGGActAGGACGCCGGCCTCCCAAGCCGGTGGtCCCGGGTTCAAATCCCGGCGGCCGCACCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna38 (1-79)	Length: 79 bp
Type: Gly	Anticodon: GCC at 37-39 (37-39)	Score: 91.07
Seq: GCGGCGGTCGTCTAGCCtGGActAGGACGCCGGCCTGCCAAGCCGGAGGtCCCGGGTTCAAATCCCGGCCGCCGCACCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna19 (1-79)	Length: 79 bp
Type: Gly	Anticodon: TCC at 37-39 (37-39)	Score: 91.33
Seq: GCGGCCGTCGTCTAGCCtGGActAGGACGCCGGCCTTCCAAGCCGGTGGtCCCGGGTTCAAATCCCGGCGGCCGCACCA
Str: >>>>>>>..>>>>...........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna22 (1-78)	Length: 78 bp
Type: His	Anticodon: GTG at 36-38 (36-38)	Score: 91.56
Seq: GCCCGGGTAGCTCAGCCtGGAtAGAGCGCCGGACTGTGGATCCGGAGGtCCCGGGTTCAAATCCCGGCCCGGGCCCCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna10 (1-77)	Length: 77 bp
Type: Ile	Anticodon: GAT at 35-37 (35-37)	Score: 95.34
Seq: GGGCCCGTAGCTCAGCCtGGTAGAGCGCCCGGCTGATAACCGGGAGGtCGGGGGTTCGAATCCCCCCGGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna6 (1-88)	Length: 88 bp
Type: Leu	Anticodon: CAA at 37-39 (37-39)	Score: 72.62
Seq: GCGGGGGTGCCCGAGCCaGGGcgAAGGGGGCGGGCTCAAGACCCGTTGGCGTAGGCCGgCGTGGGTTCAAATCCCACCCCCCGCACCA
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna25 (1-88)	Length: 88 bp
Type: Leu	Anticodon: CAG at 37-39 (37-39)	Score: 79.97
Seq: GCGGGGGTGCCCGAGCCtGGCcaAAGGGGTCGGGCTCAGGACCCGATGGCGTAGGCCTgCGTGGGTTCAAATCCCACCCCCCGCACCA
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna28 (1-88)	Length: 88 bp
Type: Leu	Anticodon: GAG at 37-39 (37-39)	Score: 79.89
Seq: GCGGGGGTGCCCGAGCCtGGCcaAAGGGGTCGGGCTGAGGACCCGATGGCGTAGGCCTgCGTGGGTTCAAATCCCACCCCCCGCACCA
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna36 (1-88)	Length: 88 bp
Type: Leu	Anticodon: TAA at 37-39 (37-39)	Score: 77.60
Seq: GCGGGGGTGCCCGAGCCtGGCcaAAGGGGGCGGGCTTAAGACCCGTTGGCGTAGGCCTgCGTGGGTTCAAATCCCACCCCCCGCACCA
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna42 (1-88)	Length: 88 bp
Type: Leu	Anticodon: TAG at 37-39 (37-39)	Score: 80.53
Seq: GCGGGGGTGCCCGAGCCtGGCcaAAGGGGTCGGGCTTAGGACCCGATGGCGTAGGCCTgCGTGGGTTCAAATCCCACCCCCCGCACCA
Str: >>>>>>>..>>>.............<<<.>>>>>.......<<<<<.>>>....<<<...>>>>>.......<<<<<<<<<<<<....
                    
chr.trna49 (1-77)	Length: 77 bp
Type: Lys	Anticodon: CTT at 35-37 (35-37)	Score: 93.13
Seq: GGGCCCGTAGCTCAGCCtGGTAGAGCGGCGGGCTCTTAACCCGTAGGtCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
BHB: GGGCCCGTAGCTCAGCCTGGTAGAGCGGCGGGCTCTTAACCCGTAG[AGGGGAGTGGAGGGGCTTCGTCCTGGCCCCGCGGAA]GTCCCGGGTTCAAATCCCGGCGGGCCCGCCA
                    
chr.trna15 (1-77)	Length: 77 bp
Type: Lys	Anticodon: TTT at 35-37 (35-37)	Score: 91.48
Seq: GGGCCCGTAGCTCAGCCcGGCAGAGCGGCGGGCTTTTAACCCGTAGGtCCCGGGTTCAAATCCCGGCGGGCCCGCCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
BHB: GGGCCCGTAGCTCAGCCCGGCAGAGCGGCGGGCTTTTAACCCGTAG[AGGGGAGTTGAGGGGCCTCGTCCTGGCCCCGCGGAA]GTCCCGGGTTCAAATCCCGGCGGGCCCGCCA
                    
chr.trna13 (1-77)	Length: 77 bp
Type: Met	Anticodon: CAT at 35-37 (35-37)	Score: 80.37
Seq: AGCGGGGTAGGGTAGCCtGGCAGCCCGCGGGGCTCATAACCCCGAGGtCGGTGGTTCAAATCCACCCCCCGCTACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna47 (1-125)	Length: 125 bp
Type: Met	Anticodon: CAT at 35-37 (35-37)	Score: 85.24
Possible intron: 39-86 (39-86)
Seq: GCCGCCGTAGCTCAGCCtGGCAGAGCGCCGGACTCATAcggcccggctaaacacccacaggccgaagtcgcctgggggcctgggagATCCGGAGGtCCCGGGTTCGAATCCCGGCGGCGGCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......................................................<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna5 (1-115)	Length: 115 bp
Type: Met	Anticodon: CAT at 35-37 (35-37)	Score: 82.11
Possible intron: 39-76 (39-76)
Seq: GGGCCCGTAGCTCAGCCaGGTAGAGCGCCCGGCTCATAccgccgggtctcgggttcgagacaagcccgcgtgagacACCGGGTGGtCGGGGGTTCAAATCCCCCCGGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.............................................<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna34 (1-75)	Length: 75 bp
Type: Phe	Anticodon: GAA at 33-35 (33-35)	Score: 87.53
Seq: GCCGCCGTAGCTCAGCGGGAGAGCGCCCGGCTGAAGACCGGGTGGtCCGGGGTTCGAATCCCCGCGGCGGCACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna51 (1-78)	Length: 78 bp
Type: Pro	Anticodon: CGG at 36-38 (36-38)	Score: 84.43
Seq: GGGCCCGTCGTCTAGCCtGGCtAGGATGCGGGGTTCGGGACCCCGTGGtCCGGGGTTCAAATCCCCGCGGGCCCACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
BHB: GGGCCCGTCGTCTAGCCTGGCTAGGATGCGGGGT[ACGGAGCAGAAGGTCCCGCTGGAGGGCGGGAGGCTCCGCCCGAC]TCGGGACCCCGTGGTCCGGGGTTCAAATCCCCGCGGGCCCACCA
                    
chr.trna30 (1-115)	Length: 115 bp
Type: Pro	Anticodon: GGG at 36-38 (36-38)	Score: 71.31
Possible intron: 40-76 (40-76)
Seq: GGGGCCGTCGTCTAGCCtGGCtAGGATGCCAGCCTGGGGagcgtatccccacccccgcgctggggggcgcccggatCGCTGGTGGtCCCGGGTTCAAATCCCGGCGGCCCCACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>............................................<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna44 (1-78)	Length: 78 bp
Type: Pro	Anticodon: TGG at 36-38 (36-38)	Score: 86.35
Seq: GGGGCCGTCGTCTAGCCtGGCtAGGATGCGGGGCTTGGGACCCCGTGGtCCGGGGTTCAAATCCCCGCGGCCCCACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna43 (1-125)	Length: 125 bp
Type: Ser	Anticodon: CGA at 35-37 (35-37)	Score: 58.61
Possible intron: 39-74 (39-74)
Seq: GCCGGGGTGGCCGAGCGGCccAAGGCGGCGGGCTCGAGgtcggcaacaggggtttccgcgccgccgcacgagagACCCGTTGCCCCGCGAGGGGCGCGCGGGTTCGAATCCCGCCCCCGGCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>...........................................<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna50 (1-88)	Length: 88 bp
Type: Ser	Anticodon: GCT at 36-38 (36-38)	Score: 81.64
Seq: GCCGCGGTCGCCTAGCCtGGCcAGGGCGCCGGCCTGCTAAGCCGGTGGGGGAGAcCCCGCGCGGGTTCAAATCCCGCCCGCGGCGCCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<..>>>.....<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna29 (1-89)	Length: 89 bp
Type: Ser	Anticodon: GGA at 35-37 (35-37)	Score: 70.89
Seq: GCCGGGGTGCCCGAGCGGTccAAGGGGACGGGCTGGAGACCCGTTGCCCCGCGAGGGGCGCGCGGGTTCGAATCCCGCCCCCGGCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna35 (1-89)	Length: 89 bp
Type: Ser	Anticodon: TGA at 35-37 (35-37)	Score: 70.62
Seq: GCCGGGGTGGCCGAGCGGCccAAGGCGGCGGGCTTGAGACCCGTTGCCCCGCGAGGGGCGCGCGGGTTCGAATCCCGCCCCCGGCGCCA
Str: >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>>....<<<<<..>>>>>.......<<<<<<<<<<<<....
                    
chr.trna52 (1-124)	Length: 124 bp
Type: Thr	Anticodon: CGT at 33-35 (33-35)	Score: 78.20
Possible intron: 37-85 (37-85)
Seq: GCCGCCGTAGCTCAGCGGTAGAGCGCCGGCCTCGTAcgggctagctccgaggtcgtccacccgccagaagtggagcccccgggacAGCCGGTGGtCGCGGGTTCGAATCCCGCCGGCGGCTCCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>........................................................<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna31 (1-76)	Length: 76 bp
Type: Thr	Anticodon: GGT at 34-36 (34-36)	Score: 88.81
Seq: GCCGCCGTAGCTCAGCTGGCAGAGCGCCGCCCTGGTAAGGCGGAGGcCCCGGGTTCGAATCCCGGCGGCGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna48 (1-76)	Length: 76 bp
Type: Thr	Anticodon: TGT at 34-36 (34-36)	Score: 90.42
Seq: GCCGCCGTAGCTCAGCAGGCAGAGCGCCGGCCTTGTAAGCCGGTGGtCGCGGGTTCGAATCCCGCCGGCGGCTCCA
Str: >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
BHB: GCCGCCGTAGCTCAGCAGGCAG[ACCCCTGCGCGGGGCCTAA]AGCGCCGGCCTTGTAAGCCGGTGGTCGCGGGTTCGAATCCCGCCGGCGGCTCCA
                    
chr.trna40 (1-77)	Length: 77 bp
Type: Trp	Anticodon: CCA at 35-37 (35-37)	Score: 88.00
Seq: GGGCCCGTAGCTCAGCCaGGCAGAGCGGCGGGCTCCAGACCCGTAGGtCGGGGGTTCAAATCCCCCCGGGCCCACCA
Str: >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
BHB: GGGCCCGTAGCTCAGCCAGGCAGAGCGGCGG[ACCCCGCATAGGCCTCCAGAGGGTGCGGGAGGCCGAG]GCTCCAGACCCGTAGGTCGGGGGTTCAAATCCCCCCGGGCCCACCA
                    
chr.trna21 (1-114)	Length: 114 bp
Type: Tyr	Anticodon: GTA at 33-35 (33-35)	Score: 71.65
Possible intron: 37-75 (37-75)
Seq: CCCGCCGTAGCTCAGCGGCAGAGCGCCCGGCTGTAGtgggacgcgggcggcgtaacccggtgtctccccgcagacACCGGGTGGtCCGGGGTTCGAATCCCCGCGGCGGGACCA
Str: >>>>>>>..>>>>.......<<<<.>>>>>..............................................<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna45 (1-78)	Length: 78 bp
Type: Val	Anticodon: CAC at 36-38 (36-38)	Score: 88.39
Seq: GGGCCCGTCGTCTAGCCtGGTtAGGACGCCGCCCTCACACGGCGGAGGtCCGGGGTTCAAATCCCCGCGGGCCCACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna16 (1-78)	Length: 78 bp
Type: Val	Anticodon: GAC at 36-38 (36-38)	Score: 87.94
Seq: GGGCCCGTCGTCTAGCCtGGTtAGGACGCCGCCCTGACGCGGCGGAGGtCCGGGGTTCAAATCCCCGCGGGCCCACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
                    
chr.trna7 (1-78)	Length: 78 bp
Type: Val	Anticodon: TAC at 36-38 (36-38)	Score: 88.94
Seq: GGGCCCGTCGTCTAGCCtGGTtAGGACGCCGCCCTTACACGGCGGAGGtCCGGGGTTCAAATCCCCGCGGGCCCACCA
Str: >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<....
         



The Genomic tRNA Database is curated by Todd Lowe and Patricia Chan. Please email lowe@soe.ucsc.edu with any questions and comments. To submit corrections, please use our Bug and Request Tracking System.