Gene: tRNA-Gln-TTG-2-1

Overview
Organism Drosophila melanogaster
Locus chrX:3427452-3427523 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Gln-TTG-2-1
FlyBase Symbol tRNA:Gln-TTG-2-1
RNAcentral ID URS0000360ADA_7227
tRNAscan-SE ID chrX.trna26
Predicted tRNA Isotype / Anticodon Gln TTG
Top Scoring / Second Best Scoring Isotype Model Gln (108.8 bits) / His (67.2 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 2
Upstream / Downstream Sequence TTGCAGCAGCGCATTTATCC / ATATATATATACATATATTG
Intron None
Possible Pseudogene No
Gene Score 68.4
HMM Score 40.50
Secondary Structure Score 27.90
Atypical Features None
Sequence
Genomic Sequence
GGTTCTATGGTGTAACGGTtAGCACTCTGGACTTTGAATCCAGCGaTCCGAGTTCAAATCTCGGTAGAACCT
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGUUCUAUGGUGUAACGGUUAGCACUCUGGACUUUGAAUCCAGCGAUCCGAGUUCAAAUCUCGGUAGAACCU
Alignments
Gln tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. GGTTCCATGGTGTAATGGTtA.GCACTCTGGACTCTGAATCCAGCG...........ATCCGAGTTCAAATCTCGGTGGAACCT tRNA-Gln-CTG-1-1 Sc: 71.5 GGTTCCATGGTGTAATGGTtA.GCACTCAGGACTCTGAATCCTGCG...........ATCCGAGTTCAAATCTCGGTGGAACCT tRNA-Gln-CTG-2-1 Sc: 69.4 GGTTCCATGGTGTAATGGTtA.GCACTCAGGACTCTGAATCCTGCG...........ATCCGAGTTCAAATCTCGGTGGAACCT tRNA-Gln-CTG-2-2 Sc: 69.4 GGTTCCATGGTGTAATGGTtA.GCACTCAGGACTCTGAATCCTGCG...........ATCCGAGTTCAAATCTCGGTGGAACCT tRNA-Gln-CTG-2-3 Sc: 69.4 GGTTCCATGGTGTAATGGTtA.GCACTCAGGACTCTGAATCCTGCG...........ATCCGAGTTCAAATCTCGGTGGAACCT tRNA-Gln-CTG-2-4 Sc: 69.4 GGTTCCATGGTGTAATGGTtA.GCACTCAGGACTCTGAATCCTGCG...........ATCCGAGTTCAAATCTCGGTGGAACCT tRNA-Gln-CTG-2-5 Sc: 69.4 GGTTCTATGGTGTAATGGTtA.GCACTTTGGACTCTGAATCCAGCG...........ATCCGAGTTCAAATCTCGGTAGAACCT tRNA-Gln-CTG-4-1 Sc: 68.9 GGTTCTATGGTGTAATGGTtA.GCACTCAGGACTCTGAATCCTGCG...........ATCCGAGTTCAAATCTCGGTAGAACCT tRNA-Gln-CTG-3-1 Sc: 68.7 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. GGTTCTATGGTGTAATGGTtA.GCACTCTGGACTTTGAATCCAGCG...........ATCCGAGTTCAAATCTCGGTAGAACCT tRNA-Gln-TTG-1-1 Sc: 70.8 GGTTCTATGGTGTAATGGTtA.GCACTCTGGACTTTGAATCCAGCG...........ATCCGAGTTCAAATCTCGGTAGAACCT tRNA-Gln-TTG-1-2 Sc: 70.8 GGTTCTATGGTGTAATGGTtA.GCACTCTGGACTTTGAATCCAGCG...........ATCCGAGTTCAAATCTCGGTAGAACCT tRNA-Gln-TTG-1-3 Sc: 70.8 GGTTCTATGGTGTAACGGTtA.GCACTCTGGACTTTGAATCCAGCG...........ATCCGAGTTCAAATCTCGGTAGAACCT tRNA-Gln-TTG-2-1 Sc: 68.4
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
33.756.334.944.749.7108.860.449.767.245.116.4-2.533.5-11.729.6No Hit18.358.940.227.745.8-11.7

Top score2nd highest score3rd highest score