Gene: tRNA-Gly-GCC-1-4

Overview
Organism Drosophila melanogaster
Locus chr2L:14518091-14518161 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Gly-GCC-1-4
FlyBase Symbol tRNA:Gly-GCC-1-4
RNAcentral ID URS00003429B0_7227
tRNAscan-SE ID chr2L.trna20
Predicted tRNA Isotype / Anticodon Gly GCC
Top Scoring / Second Best Scoring Isotype Model Gly (108.6 bits) / Asp (75.0 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 2
Upstream / Downstream Sequence TCAGCTAAAGAATTTACGAA / TAATACTTTTTTAAACTTTT
Intron None
Possible Pseudogene No
Gene Score 80.1
HMM Score 59.20
Secondary Structure Score 20.90
Atypical Features None
Sequence
Genomic Sequence
GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA
Secondary Structure (nested bp)
>>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCAUCGGUGGUUCAGUGGUAGAAUGCUCGCCUGCCACGCGGGCGGCCCGGGUUCGAUUCCCGGCCGAUGCA
Alignments
Gly tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-1 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-10 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-11 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-12 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-13 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-2 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-3 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-4 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-5 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-6 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-7 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-8 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-1-9 Sc: 80.1 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCTGGGTTCGATTCCCGGCCGATGCA tRNA-Gly-GCC-2-1 Sc: 76.7 GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGGCCGATGCA DG9240_GCC_DROSOPHILA_MELANO >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>.......<<<<.<<<<<<<. GCATCGGTGGTTCAGTGGT.A.GAATGCTCGCCTGCCACGCGGGCG...........GCCCGGGTTCGATTCCCGACCGATGCA DG9241_GCC_DROSOPHILA_MELANO >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. GCGTCGGTGGTGTAATGGTtA.GCATAGTTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCGACGCA tRNA-Gly-TCC-1-1 Sc: 73.1 GCGTCGGTGGTGTAATGGTtA.GCATAGTTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCGACGCA tRNA-Gly-TCC-1-2 Sc: 73.1 GCGTCGGTGGTGTAATGGTtA.GCATAGTTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCGACGCA tRNA-Gly-TCC-1-3 Sc: 73.1 GCGTCGGTGGTGTAATGGTtA.GCATAGTTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCGACGCA tRNA-Gly-TCC-1-4 Sc: 73.1 GCGTCGGTGGTGTAATGGTcA.GCATAGTTGCCTTCCAAGCAGTTG...........ATCCGGGTTCGATTCCCGGCCGACGCA tRNA-Gly-TCC-2-1 Sc: 70.6 GCGTCGGTGGTGTAATGGTcA.GCATAGTTGCCTTCCAAGCAGTTG...........ATCCGGGTTCGATTCCCGGCCGACGCA tRNA-Gly-TCC-2-2 Sc: 70.6
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
70.058.028.875.054.251.052.8108.662.946.417.531.543.129.066.5No Hit16.668.465.051.061.6-18.4

Top score2nd highest score3rd highest score