Gene: tRNA-Lys-TTT-2-4

Overview
Organism Drosophila melanogaster
Locus chr3R:6822963-6823035 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Lys-TTT-2-4
FlyBase Symbol tRNA:Lys-TTT-2-4
RNAcentral ID URS00004699F5_7227
tRNAscan-SE ID chr3R.trna77
Predicted tRNA Isotype / Anticodon Lys TTT
Top Scoring / Second Best Scoring Isotype Model Lys (108.5 bits) / Arg (83.3 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 2
Upstream / Downstream Sequence TTGGCGAATGACGTTCACAT / GCAATCTTTTTGCCTTTTTT
Intron None
Possible Pseudogene No
Gene Score 88.5
HMM Score 68.40
Secondary Structure Score 20.10
Atypical Features None
Known Modifications (Modomics) m2G10 D16 D20 Ψ27 Ψ28 cmnm5Um34 t6A37 Ψ39 m7G46 D47 m5C48 m5Um54 Ψ55 m1A58
Sequence
Genomic Sequence
GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGGGtCCAGGGTTCAAGTCCCTGTTCGGGCG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCCCGGAUAGCUCAGUCGGUAGAGCAUUGGACUUUUAAUCCAAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCG
Alignments
Lys tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-1 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-10 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-11 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-12 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-13 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-2 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-3 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-4 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-5 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-6 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-7 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-8 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... tRNA-Lys-CTT-1-9 Sc: 87.8 GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCG... DK9240_CTT_DROSOPHILA_MELANO GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTCAGG...........GtCGTGGGTTCGAGCCCCACGTTGGGCGcca RK9240_CTT_DROSOPHILA_MELANO >>>>>>>..>>>>........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GCCCGGGTAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGCTCGGGCG... tRNA-Lys-TTT-1-1 Sc: 88.8 GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCG... tRNA-Lys-TTT-2-1 Sc: 88.5 GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCG... tRNA-Lys-TTT-2-2 Sc: 88.5 GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCG... tRNA-Lys-TTT-2-3 Sc: 88.5 GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCG... tRNA-Lys-TTT-2-4 Sc: 88.5 GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCG... tRNA-Lys-TTT-2-5 Sc: 88.5 GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCG... DK9241_TTT_DROSOPHILA_MELANO GCCCGGATAGCTCAGTCGGTAGAGCATTGGACTTTTAATCCAAGG...........GtCCAGGGTTCAAGTCCCTGTTCGGGCGcca RK9241_TTT_DROSOPHILA_MELANO
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.283.381.354.772.049.938.242.746.573.123.8108.570.357.644.2No Hit18.182.775.667.147.1-12.9

Top score2nd highest score3rd highest score