Gene: tRNA-Ala-AGC-15-1

Overview
Organism Homo sapiens
Locus chr14:89445442-89445514 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Ala-AGC-15-1
HGNC Symbol TRA-AGC15-1
RNAcentral ID URS00006E0E1A_9606
tRNAscan-SE ID chr14.trna9
GtRNAdb 2009
Legacy Name and Score
chr14.trna9-AlaAGC (59.85 bits)
Predicted tRNA Isotype / Anticodon Ala AGC
Top Scoring / Second Best Scoring Isotype Model Ala (92.0 bits) / Thr (45.0 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 15 out of 23
Upstream / Downstream Sequence GATGACCATCAGGATCACAT / TACGTTACCATTTGAATCTT
Intron None
Possible Pseudogene No
Gene Score 56.7
Mature tRNA Score 56.7
HMM Score 35.80
Secondary Structure Score 20.90
Atypical Features A54
Known Modifications (Modomics) m2G10 D17 D20 m2,2G26 Um32 I34 m1I37 Ψ38 Gm39 m7G46 Ψ55 m1A58
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGGGAATTAGCTCAAGTGGTAGAGCGCTCGCTTAGCATGCGAGAGGtAGTGGGATCGATGCCCGCATTCTCCA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGGGAAUUAGCUCAAGUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGUGGGAUCGAUGCCCGCAUUCUCCA
Alignments
Ala tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGGTATAGCTCAGT.GGTA.GAGCGCGTGCTTAGCATGCACGAG...........GtCCTGGGTTCGATCCCCAGTACCTCCA... tRNA-Ala-AGC-1-1 Sc: 84.9 GGGGGTGTAGCTCAGT.GGTA.GAGCGCGTGCTTAGCATGCACGAG...........GcCCCGGGTTCAATCCCCGGCACCTCCA... tRNA-Ala-AGC-2-1 Sc: 84.7 GGGGGTGTAGCTCAGT.GGTA.GAGCGCGTGCTTAGCATGCACGAG...........GcCCCGGGTTCAATCCCCGGCACCTCCA... tRNA-Ala-AGC-2-2 Sc: 84.7 GGGGGTGTAGCTCAGT.GGTA.GAGCGCGTGCTTAGCATGCACGAG...........GcCCTGGGTTCAATCCCCAGCACCTCCA... tRNA-Ala-AGC-5-1 Sc: 84.2 GGGGGTGTAGCTCAGT.GGTA.GAGCGCGTGCTTAGCATGTACGAG...........GtCCCGGGTTCAATCCCCGGCACCTCCA... tRNA-Ala-AGC-3-1 Sc: 80.3 GGGGGTGTAGCTCAGT.GGTA.GAGCGCGTGCTTAGCATGCACGAG...........GcCCCGGGTTCAATCCCTGGCACCTCCA... tRNA-Ala-AGC-7-1 Sc: 78.5 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>.>>>.......<<<.<<<<<<<<.... GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTAGCATGCATGAG...........GtCCCGGGTTCGATCCCCAGCATCTCCA... tRNA-Ala-AGC-4-1 Sc: 76.1 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.................>>>>.......<<<<.<<<<<<<.... GGGGGTATAGCTCAGC.GGTA.GAGCGCGTGCTTAGCATGCACGAG...........GtCCTGGGTTCAATCCCCAATACCTCCA... tRNA-Ala-AGC-6-1 Sc: 74.1 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGAATTAGCTCAAGTGGTA.GAGCGCTTGCTTAGCACGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-10-1 Sc: 60.1 GGGGAATTAGCTCAAGTGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-12-1 Sc: 60.0 GGGGAATTAGCTCAAGTGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-12-2 Sc: 60.0 GGGGAATTAGCTCAAGTGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-12-3 Sc: 60.0 GGGGGATTAGCTCAAATGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGATGCCCGCATCCTCCA... tRNA-Ala-AGC-8-1 Sc: 59.7 GGGGGATTAGCTCAAATGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGATGCCCGCATCCTCCA... tRNA-Ala-AGC-8-2 Sc: 59.7 GGGGAATTAGCTCAAATGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGATGCCCGCATTCTCCA... tRNA-Ala-AGC-11-1 Sc: 58.9 GGGGAATTAGCTCAAGTGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCAATGCCCACATTCTCCA... tRNA-Ala-AGC-14-1 Sc: 58.9 GGGGAATTAGCTCAAGCGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-13-1 Sc: 58.7 GGGGAATTAGCTCAAGCGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-13-2 Sc: 58.7 GGGGAATTAGCTCAGGCGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGACGCCCGCATTCTCCA... tRNA-Ala-AGC-9-1 Sc: 58.3 GGGGAATTAGCTCAGGCGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGACGCCCGCATTCTCCA... tRNA-Ala-AGC-9-2 Sc: 58.3 GGGGAATTAGCTCAAGTGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGTGGGATCGATGCCCGCATTCTCCA... tRNA-Ala-AGC-15-1 Sc: 56.7 >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGAATTAGCCCAAGTGGTA.GAGCGCTTGCTTAGCATGCAAGAG...........GtAGTGGGATCGATGCCCACATTCTCCA... tRNA-Ala-AGC-16-1 Sc: 53.1 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGGATTAGCTCAAATGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGATGCCCGCATCCTCCAcca RA9990_AGC_HUMAN_CY GGGGAATTAGCTCAAATGGTA.GAGCGCTCGCTTAGCATGCGAGAG...........GtAGCGGGATCGATGCCCGCATTCTCCAcca RA9991_AGC_HUMAN_CY >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTCGCATGTATGAG...........GtCCCGGGTTCGATCCCCGGCATCTCCA... tRNA-Ala-CGC-1-1 Sc: 79.7 GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTCGCATGTATGAG...........GcCCCGGGTTCGATCCCCGGCATCTCCA... tRNA-Ala-CGC-2-1 Sc: 79.7 >>>>>.>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<.<<<<<.... GGGGGTGTAGCTCAGT.GGTA.GAGCGCGTGCTTCGCATGTACGAG...........GcCCCGGGTTCGACCCCCGGCTCCTCCA... tRNA-Ala-CGC-4-1 Sc: 76.1 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGATGTAGCTCAGT.GGTA.GAGCGCGCGCTTCGCATGTGTGAG...........GtCCCGGGTTCAATCCCCGGCATCTCCA... tRNA-Ala-CGC-3-1 Sc: 74.4 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGGTGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........GtCCCGGGTTCGATCCCCGGCACCTCCA... tRNA-Ala-TGC-1-1 Sc: 80.5 GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........GtCCCGGGTTCGATCCCCGGCATCTCCA... tRNA-Ala-TGC-2-1 Sc: 79.7 GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........GcCCCGGGTTCGATCCCCGGCATCTCCA... tRNA-Ala-TGC-3-1 Sc: 79.7 GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........GcCCCGGGTTCGATCCCCGGCATCTCCA... tRNA-Ala-TGC-3-2 Sc: 79.7 GGGGATGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCACGTATGAG...........GcCCCGGGTTCAATCCCCGGCATCTCCA... tRNA-Ala-TGC-4-1 Sc: 78.8 GGGGGTGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........GcCTCGGGTTCGATCCCCGACACCTCCA... tRNA-Ala-TGC-5-1 Sc: 75.3 GGGGGTGTAGCTCAGT.GGTA.GAGCACATGCTTTGCATGTGTGAG...........GcCCCGGGTTCGATCCCCGGCACCTCCA... tRNA-Ala-TGC-6-1 Sc: 74.2 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.................>.>>.......<<.<.<<<<<<<.... GGGGGTGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........G.CCTCGGTTCGATCCCCGACACCTCCA... tRNA-Ala-TGC-7-1 Sc: 60.0 GGGGGTGTAGCTCAGT.GGTA.GAGCGCATGCTTTGCATGTATGAG...........G.CCTCGGTTCGATCCCCGACACCTCCA... DA9990_TGC_HUMAN_CY
>>.>>>>>.....>.>>...........<<.<..>.>>>.........<<<.<................>>.>>.............<<.<<..<<<<<<<. GG.GGGTG...TAGATCAGT.GGT.A..GAGCG.CATGCTTCG.C.ATGTACGAG...........GtCCCTGG..TTCAATC....CCTGG..TACCTCCA tRNA-Ala-CGC-5-1 Sc: 52.8 (filtered) best isotype model: Ala Sc: 87.8 >>.>>>>>.....>>>>...........<<<<...>>>>.........<<<<.................>>>>>.............<<<<<..<<<<<<<. GG.GGGTG...TAGCTCAGT.GGT.A..GAGCG.GATGCTTTG.C.ATGTATGAG...........AcTTTGGG..TTGGATC....CCCAG..CACCTCCA tRNA-Ala-TGC-8-1 Sc: 48.9 (filtered) best isotype model: Ala Sc: 83.3 >>.>>>>>.....>>.>...........<.<<..>>>>>.........<<<<<................>>>>>.............<<<<<..<<<<<<<. GG.GGAAT...TAGCGCAAGTGGT.A..GAGTG.CTTGCTTAG.C.ATGCAAGAG...........GtAGTGGG..ATCGATG....CCCAC..ATTCTCCA tRNA-Ala-AGC-17-1 Sc: 46.4 (filtered) best isotype model: Ala Sc: 82.1 >>.>>>>>.....>.>>...........<<.<..>>.>>.........<<.<<................>>>>>.............<<<<<..<<<<<<<. GG.GGGTG...TAGATCAGT.GGT.A..GGGCG.CACGCTTAG.C.ATGCATGAG...........GcCCTGGG...TCAATC....CCCAG..CACCTCCA tRNA-Ala-AGC-20-1 Sc: 47.4 (filtered) best isotype model: Ala Sc: 76.5 >>.>>>>>.....>>>>...........<<<<..>.>>>.........<<<.<................>>>>>.............<<<<<..<<<<<<<. GG.GGGAT...TAGCTCAAGCGGT.A..GAGCG.CCTGCTTAG.C.ATGCAAGAG...........GtAGCAGG..ATCGATG....CCTGC..ATTCTCCA tRNA-Ala-AGC-19-1 Sc: 49.5 (filtered) best isotype model: Ala Sc: 76.3 >>.>>>.>.....>>>>...........<<<<..>>>>>.........<<<<<................>>>>>.............<<<<<..<.<<<<<. GG.GGAAT...TGGCTCAAGCGGT.A..GAGCG.CTTGCTTAG.C.ATGCAAGAG...........GtAGCAGG..ATCGACG....CCTGC..ACTCTCCA tRNA-Ala-AGC-18-1 Sc: 47.3 (filtered) best isotype model: Ala Sc: 76.1 GG.GGAAT...TGGCTCAAGCGGT.A..GAGCG.CTTGCTTAG.C.ATGCAAGAG...........GtAGCAGG..ATCGACG....CCTGC..ACTCTCCA tRNA-Ala-AGC-18-2 Sc: 47.3 (filtered) best isotype model: Ala Sc: 76.1 >>.>>>>>.....>>>>...........<<<<..>>>>>.........<<<<<................>>>.>.............<.<<<..<<<<<<<. GG.GGAAT...TAGCTCAGGCGGT.G..GAGCG.CTCGCTTAGcT.ATGCGAGAG...........GtAGCGAG..ATCGACG....CCCGC..ATTCTCCA tRNA-Und-NNN-1-1 Sc: 31.4 (filtered) best isotype model: Ala Sc: 73.4 >>.>>>>>.....>>>>...........<<<<..>>.>>.........<<.<<................>>>>...............<<<<..<<<<<<<. GGtGGATG...TAGTTTAGT.GGT.A..GAACG.CGCGCTTTG.C.ATGTATGAG...........GtCCCGGT..TTCGATC....CCTGG..CGTTTCCA tRNA-Ala-TGC-9-1 Sc: 38.1 (filtered) best isotype model: Ala Sc: 67.8 >>.>>>>>.....>>>>...........<<<<..>.>>>.........<<<.<................>>>>>.............<<<<<..<<<<<<<. GG.GGGAT...TAGCTCAAGCGGT.A..GGGTG.CCTGCTTAG.C.ATGCAAGAG...........GtAGCAGG..ATCGACG....CCTGC..ATTCTCCA tRNA-Ala-AGC-21-1 Sc: 40.0 (filtered) best isotype model: Ala Sc: 64.7 >>.>>>>>......>>>...........<<<...>>>.>.........<.<<<................>>>>>.............<<<<<..<<<<<<<. GG.GGGTA...TAGCTCAGT.GGT.A..GAGAG.TGTACTTAT.C.ATGCACGAG...........GtCTTGGGct...GATT...cCCCAG..TACCTCCA tRX-Asp-NNN-1-1 Sc: 34.9 (filtered) best isotype model: Ala Sc: 63.5 >..>>>>......>>>>...........<<<<..>>>>>.........<<<<<................>>>>>.............<<<<<...<<<<.<. GA.AGAAG...TAGCTCAAGTGGT.G..GAGTG.CTCGCTTAG.C.ATGTGAGAG...........GtAGTGGG..ATTGATG....CCCAC..ATTCTCCA tRX-Ala-NNN-1-1 Sc: 24.8 (filtered) best isotype model: Ala Sc: 62.3 GA.AGAAG...TAGCTCAAGTGGT.G..GAGTG.CTCGCTTAG.C.ATGTGAGAG...........GtAGTGGG..ATTGATG....CCCAC..ATTCTCCA tRX-Ala-NNN-1-2 Sc: 24.8 (filtered) best isotype model: Ala Sc: 62.3 >>.>>>>>.....>>>>...........<<<<..>>>.>.........<.<<<................>.>>>.............<<<.<..<<<<<<<. GG.GGAAT...TAGCTCAAGCGGT.A..GAGCG.CTCCCTTAG.C.ATGCGAGAG...........GtAGCGGG..ATCGACG....CCCCC..ATTCTCTA tRNA-Ala-AGC-22-1 Sc: 31.6 (filtered) best isotype model: Ala Sc: 57.9 >..>>>>......>>>>...........<<<<..>>>>>.........<<<<<................>>>>>.............<<<<<...<<<<.<. GA.AGAAG...TAGCTCAAGTGGT.C..GAGTG.CTCGCTTAG.C.ATGTGAGAG...........GtAGTGGG..ATTGATG....CCCAC..ATTCTCCA tRX-Ala-NNN-2-1 Sc: 26.3 (filtered) best isotype model: Ala Sc: 55.8 >>.>>>>>.....>>>>...........<<<<..>>>>...........<<<<................>>>.>.............<.<<<..<<<<<<<. GG.GGGTA...TAGCTCAG..GGAcA..GAGCA.CGTGGTTAG.C.ATGCGTGAG...........GtCCTGCG..TTCAACT....TCCAG..TATTTCCA tRNA-Ala-AGC-23-1 Sc: 22.7 (filtered) best isotype model: Ala Sc: 46.0 >>.>>>.>.....>>.>...........<.<<..>>>>...........<<<<................>>>>>.............<<<<<..<.<<<<<. GG.TAGTG...TAGTCTACT.GGT.T..AAACGcTTGGGCTCT.G.ACATTAAC............GtCCTGGG..TTCAAAT....CCCAG..CTTTGTCA tRNA-Gln-CTG-13-1 Sc: 22.8 (filtered) best isotype model: Ala Sc: 15.4 >>.>.>.>.....>>>.............<<<..>>>>>.........<<<<<................>>>>>.............<<<<<..<.<.<<<. CC.CAATGctgTAGCTCAGC.AGTtA..AGGTT.TGCCATTTT.AcAATGGCA.............G.CCTGGG..TTCAATT....CCCAG..CTTAGGGA tRX-Und-NNN-8-1 Sc: 20.5 (filtered) best isotype model: Ala Sc: 11.7
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
92.026.01.84.133.5No HitNo Hit21.812.322.1No Hit21.842.637.741.0No Hit-12.945.026.99.822.1-15.1
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
-6.2No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (27)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
5 (5′ Acceptor Stem)chr14:89445446rs774188227A / GNoNoGU base pair
7 (5′ Acceptor Stem)chr14:89445448rs552636066T / CNoNobase pair mismatch
17 (D-loop)chr14:89445458rs570784233T / CNoNosubstitution in loop
25 (3′ D-arm)chr14:89445466rs116879660C / ANoYesbase pair mismatch
25 (3′ D-arm)chr14:89445466rs116879660C / TNoYesGU base pair
27 (5′ Anticodon Stem)chr14:89445468rs538226045C / TNoNoGU base pair
29 (5′ Anticodon Stem)chr14:89445470rs370577577C / TNoNoGU base pair
30 (5′ Anticodon Stem)chr14:89445471rs767421932G / ANoNobase pair mismatch
31 (5′ Anticodon Stem)chr14:89445472rs560505888C / TNoYesGU base pair
36 (Anticodon Loop)chr14:89445477rs189364787C / TNoYesnon synonymous anticodon change
37 (Anticodon Loop)chr14:89445478rs371758526- / TNoYessubstitution in loop
40 (3′ Anticodon Stem)chr14:89445481rs4904491C / TYesYesGU base pair
50 (5′ T-arm)chr14:89445491rs182331700T / ANoYesbase pair mismatch
52 (5′ T-arm)chr14:89445493rs567122276G / ANoNobase pair mismatch
53 (5′ T-arm)chr14:89445494rs764232616G / ANoNobase pair mismatch
55 (T-Psi-C Loop)chr14:89445496rs537281342T / ANoYesuniversal base change
56 (T-Psi-C Loop)chr14:89445497rs550789183C / TNoYesuniversal base change
57 (T-Psi-C Loop)chr14:89445498rs115109247G / ANoYessubstitution in loop
57 (T-Psi-C Loop)chr14:89445498rs115109247G / TNoYessubstitution in loop
58 (T-Psi-C Loop)chr14:89445499rs552708794A / GNoYesuniversal base change
59 (T-Psi-C Loop)chr14:89445500rs143355673T / CNoYessubstitution in loop
60 (T-Psi-C Loop)chr14:89445501rs367590992G / ANoNosubstitution in loop
61 (3′ T-arm)chr14:89445502rs753512395C / TNoNoGU base pair
62 (3′ T-arm)chr14:89445503rs78689848C / TYesYesGU base pair
63 (3′ T-arm)chr14:89445504rs555085726C / TNoYesGU base pair
70 (3′ Acceptor Stem)chr14:89445511rs778272088T / ANoNobase pair mismatch
73 (3′ end)chr14:89445514rs56026458A / GNoYessubstitution in loop
Expression Profiles