Gene: tRNA-Arg-CCG-1-3

Overview
Organism Homo sapiens
Locus chr16:3200675-3200747 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Arg-CCG-1-3
HGNC Symbol TRR-CCG1-3
RNAcentral ID URS00001D909A_9606
tRNAscan-SE ID chr16.trna2
GtRNAdb 2009
Legacy Name and Score
chr16.trna1-ArgCCG (69.88 bits)
Predicted tRNA Isotype / Anticodon Arg CCG
Top Scoring / Second Best Scoring Isotype Model Arg (100.7 bits) / Thr (66.3 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 2
Upstream / Downstream Sequence TGGGAGCCATACAGCCGCAG / TTGCCATGTTAACGTTTTCT
Intron None
Possible Pseudogene No
Gene Score 67.0
Mature tRNA Score 67.0
HMM Score 49.40
Secondary Structure Score 17.60
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCCGCGTGGCCTAATGGAtAAGGCGTCTGATTCCGGATCAGAAGAtTGAGGGTTCGAGTCCCTTCGTGGTCG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCCGCGUGGCCUAAUGGAUAAGGCGUCUGAUUCCGGAUCAGAAGAUUGAGGGUUCGAGUCCCUUCGUGGUCG
Alignments
Arg tRNAs
.>>>>>>>..>>>............<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-1 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-2 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-3 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-1 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-2 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-3 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-4 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG DR9990_ACG_HUMAN_CY .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-1 Sc: 67.0 .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-2 Sc: 67.0 .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-3 Sc: 67.0 .GACCCAGTGGCCTAATGGAt.A.AGGCATCAGCCTCCGG..................AGCTGGGG...........AtTGTGGGTTCGAGTCCCATCTGGGTCG tRNA-Arg-CCG-2-1 Sc: 64.9 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGCAGGTTCGAGTCCTGCCGCGGTCG tRNA-Arg-TCG-1-1 Sc: 74.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTCCGTGGTTA tRNA-Arg-TCG-2-1 Sc: 70.3 .GACCGCGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-TCG-3-1 Sc: 68.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTTA tRNA-Arg-TCG-4-1 Sc: 66.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTTG tRNA-Arg-TCG-5-1 Sc: 65.5 .>>>>>>>..>>>>..........<<<<.>.>>>.........................<<<.<................>>>>>.......<<<<<<<<<<<<. .GGCCGTGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAAAAG...........AtTGCAGGTTTGAGTTCTGCCACGGTCG tRNA-Arg-TCG-6-1 Sc: 53.7 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. gGACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTT. DR9991_TCG_HUMAN_CY .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GCCCCAGTGGCCTAATGGAt.A.AGGCACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCTGGGGTA tRNA-Arg-CCT-1-1 Sc: 72.3 .GCCCCGGTGGCCTAATGGAt.A.AGGCATTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCCGGGGTA tRNA-Arg-CCT-3-1 Sc: 71.7 .GCCCCAGTGGCCTAATGGAt.A.AGGCACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCTGGGGTG tRNA-Arg-CCT-2-1 Sc: 71.1 .GCCCCAGTGGCCTAATGGAt.A.AGGCATTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCATCTGGGGTG tRNA-Arg-CCT-4-1 Sc: 65.6 .GCCCCAGTGGCCTGATGGAt.A.AGGTACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTTCCACCTGGGGTA tRNA-Arg-CCT-5-1 Sc: 54.7 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GTCTCTGTGGCGCAATGGAcgA.GCGCGCTGGACTTCTA..................ATCCAGAG...........GtTCCGGGTTCGAGTCCCGGCAGAGATG tRNA-Arg-TCT-4-1 Sc: 78.5 .GGCTCCGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgaggctgaaggc......ATTCAAAG...........GtTCCGGGTTCGAGTCCCGGCGGAGTCG tRNA-Arg-TCT-1-1 Sc: 71.1 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgtgacgaatagagca...ATTCAAAG...........GtTGTGGGTTCGAATCCCACCAGAGTCG tRNA-Arg-TCT-2-1 Sc: 70.8 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgatagttagagaa.....ATTCAAAG...........GtTGTGGGTTCGAGTCCCACCAGAGTCG tRNA-Arg-TCT-3-2 Sc: 70.3 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgctgagcctagtgtggtcATTCAAAG...........GtTGTGGGTTCGAGTCCCACCAGAGTCG tRNA-Arg-TCT-3-1 Sc: 70.1 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>.>>>.......<<<.<<<<<<<<. .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgcctaaatcaagag....ATTCAAAG...........GtTGCGGGTTCGAGTCCCTCCAGAGTCG tRNA-Arg-TCT-5-1 Sc: 61.4
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GACCGTGTGGCCTtAATGGAtA.AGGTGTCTGACTTCAGATCAGAAG...........AtTGAGGGTTTGAGTCCCTTTGTGGTCA tRNA-SeC-TCA-3-1 Sc: 48.8 (filtered) best isotype model: Arg Sc: 63.6 >>>>>>>..>>..............<<.>>>>>.......<<<<<................>>>>.........<<<<<<<<<<<. GGGCCAGTGGCTC.AATGGAtA.ATGCGTCTGACTAAGAATCAGAAG...........AtTCCAGCCTTGACTCCTGGCTGGCTCA tRNA-Leu-AAG-5-1 Sc: 37.7 (filtered) best isotype model: Arg Sc: 62.5 >>>>>>>..>.>>..........<<.<.>>>.>.......<.<<<................>>>>>.......<<<<<<<<<<<<. GACCATGTGGCCT.AAGGGAaA.AGACATCTCACTTTGGGTCAGAAG...........AtTGAGGGTTCAAGTCCTTTCATGGTCA tRNA-Gln-TTG-6-1 Sc: 31.7 (filtered) best isotype model: Arg Sc: 38.8 .>>>>>>..>>>............<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<.. AGGCCAGTGGCGC.AAGGGAtA.ACGTGTCTGACCACGCATCAGAAG...........AtTGTAGGTCCAGCTCCTGCCTGGCTCG tRX-Arg-NNN-1-1 Sc: 24.8 (filtered) best isotype model: Arg Sc: 37.7
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
36.3100.758.716.142.541.58.920.545.258.632.933.038.4-11.215.2No Hit32.366.365.914.539.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (28)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr16:3200675rs377111066G / ANoNobase pair mismatch
3 (5′ Acceptor Stem)chr16:3200677rs540207836C / TNoNoGU base pair
5 (5′ Acceptor Stem)chr16:3200679rs777900398G / ANoNorestore Watson-Crick base pair
7 (5′ Acceptor Stem)chr16:3200681rs747236326G / ANoNobase pair mismatch
11 (5′ D-arm)chr16:3200685rs778826571C / TNoNoGU base pair
15 (D-loop)chr16:3200689rs771014238A / GNoNosubstitution in loop
16 (D-loop)chr16:3200690rs528701234T / CNoYessubstitution in loop
20 (D-loop)chr16:3200693rs548357856A / CNoYessubstitution in loop
20 (D-loop)chr16:3200693rs548357856A / GNoYessubstitution in loop
20a (D-loop)chr16:3200694rs768595373T / GNoNosubstitution in loop
35 (Anticodon Loop)chr16:3200709rs745863175C / GNoNonon synonymous anticodon change
36 (Anticodon Loop)chr16:3200710rs568245530G / ANoYesnon synonymous anticodon change
37 (Anticodon Loop)chr16:3200711rs182527812G / ANoYessubstitution in loop
40 (3′ Anticodon Stem)chr16:3200714rs560463419C / TNoNoGU base pair
43 (3′ Anticodon Stem)chr16:3200717rs550970797A / GNoYesGU base pair
45 (Variable Loop)chr16:3200719rs767319862G / ANoNosubstitution in loop
45 (Variable Loop)chr16:3200719rs766389954- / TNoNosubstitution in loop
46 (Variable Loop)chr16:3200720rs750134982A / CNoNosubstitution in loop
47 (Variable Loop)chr16:3200721rs532586506T / CNoNosubstitution in loop
49 (5′ T-arm)chr16:3200723rs570717144G / ANoYesrestore Watson-Crick base pair
53 (5′ T-arm)chr16:3200727rs866182764G / CNoNobase pair mismatch
55 (T-Psi-C Loop)chr16:3200729rs538930231T / GNoYesuniversal base change
57 (T-Psi-C Loop)chr16:3200731rs765875824G / ANoNosubstitution in loop
61 (3′ T-arm)chr16:3200735rs753408241C / GNoNobase pair mismatch
62 (3′ T-arm)chr16:3200736rs144245291C / ANoYesbase pair mismatch
66 (3′ Acceptor Stem)chr16:3200740rs754518754C / ANoNobase pair mismatch
69 (3′ Acceptor Stem)chr16:3200743rs565961995G / ANoYesbase pair mismatch
72 (3′ Acceptor Stem)chr16:3200746rs186749334C / TNoYesGU base pair
Expression Profiles