Gene: tRNA-Asn-GTT-14-1

Overview
Organism Homo sapiens
Locus chr1:144481840-144481913 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asn-GTT-14-1
HGNC Symbol TRN-GTT14-1
RNAcentral ID URS00006446BE_9606
tRNAscan-SE ID chr1.trna12
GtRNAdb 2009
Legacy Name and Score
chr1.trna12-AsnGTT (53.66 bits)
Predicted tRNA Isotype / Anticodon Asn GTT
Top Scoring / Second Best Scoring Isotype Model Asn (91.0 bits) / Val (49.0 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 14 out of 23
Upstream / Downstream Sequence CAGTGGAGTTAGCAGTGCTT / CTTATTGGAACTTTTAAAGC
Intron None
Possible Pseudogene No
Gene Score 48.0
Mature tRNA Score 48.0
HMM Score 33.30
Secondary Structure Score 14.70
Atypical Features C30:C40 U56
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GTCTCTGTGGTGCAATCGGTtAGCGCGTTCCGCTGTTAACCGAAAGCtTGGTGGTTTGAGCCCACCCAGGGATG
Secondary Structure (nested bp)
>>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GUCUCUGUGGUGCAAUCGGUUAGCGCGUUCCGCUGUUAACCGAAAGCUUGGUGGUUUGAGCCCACCCAGGGAUG
Alignments
Asn tRNAs
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGATCCCACCCAGGGACG... tRNA-Asn-GTT-1-1 Sc: 81.5 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-1 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-2 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-3 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-4 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-5 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-6 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCATTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-3-1 Sc: 79.7 GTCTCTGTGGCGCAATCGGTtA.GCGCATTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-3-2 Sc: 79.7 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........AtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-4-1 Sc: 77.7 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACTGAAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-5-1 Sc: 76.5 GTCTCTGTGGCGCAATGGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCATCCAGGGACG... tRNA-Asn-GTT-6-1 Sc: 73.8 GTCTCTGTGGCGCAATCGGCtA.GCGCGTTTGGCTGTTAACTAAAAG...........GtTGGTGGTTCGAACCCACCCAGAGGCG... tRNA-Asn-GTT-8-1 Sc: 69.8 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<.................>>>>.......<<<<.<<<<<<<.... GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACTGAAAG...........GtTAGTGGTTCGAGCCCACCCGGGGACG... tRNA-Asn-GTT-9-1 Sc: 68.6 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACTGAAAG...........GtTAGTGGTTCGAGCCCACCCGGGGACG... tRNA-Asn-GTT-9-2 Sc: 68.6 >>.>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<.<<.... GTCTCTGTGGCGTAGTCGGTtA.GCGCGTTCGGCTGTTAACCGAAAA...........GtTGGTGGTTCGAGCCCACCCAGGAACG... tRNA-Asn-GTT-7-1 Sc: 67.8 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>.>>.......<<.<<<<<<<<<.... GTCTCTGTGGCGCAATCGGCtA.GCGCGTTTGGCTGTTAACTAAAAG...........GtTGGCGGTTCGAACCCACCCAGAGGCG... tRNA-Asn-GTT-10-1 Sc: 62.7 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>.........<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGCtA.GCGCGTTTGGCTGTTAACTAAAAA...........GtTGGTGGTTCGAACACACCCAGAGGCG... tRNA-Asn-GTT-12-1 Sc: 54.5 >>>>>>>..>>>>..........<<<<.>>>.>.......<.<<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGTGCAATCGGTtA.GCGCGTTCCGCTGTTAACCGAAAG...........CtTGGTGGTTCGAGCCCACCCAGGGATG... tRNA-Asn-GTT-11-1 Sc: 53.5 GTCTCTGTGGTGCAATCGGTtA.GCGCGTTCCGCTGTTAACCGAAAG...........CtTGGTGGTTCGAGCCCACCCAGGGATG... tRNA-Asn-GTT-11-2 Sc: 53.5 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATGGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGTTCGAGCCCATCCAGGGACG... DN9990_GTT_HUMAN_CY GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........AtTGGTGGTTCGAGCCCACCCAGGGACG... DN9991_GTT_HUMAN_CY GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCGAAAG...........GtTGGTGGNTCGAGCCCACCCAGGGACGcca RN9990_GTT_HUMAN_LIVER/PLAC GGTCCCATGGTGTAAT.GGTtA.GCACTCTGGACTNTGAATCCAGCG...........A.TCCGAGTTCAAATCTCGGTGGGACCTcca RN9991_NTG_HUMAN_CY >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... RN9991_NTG_HUMAN_CY
>>>>>>>..>>>>............<<<<.>>>.>.........<.<<<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGTGCAATCGGTtA...GCGCGTTCCGCTGTT..AACCGAAAG...........CtTGGTGGTTTGAGCCCACCCAGGGATG tRNA-Asn-GTT-14-1 Sc: 48.0 (filtered) best isotype model: Asn Sc: 91.0 >>>>>>>..>>>>............<<<<.>..>>.........<<..<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGTGCAATCGGTtA...GCGCGTTCGGCTGTT..AACCATAAG...........GtTGGTGGTTAGAGACCACCCAGGGACG tRNA-Asn-GTT-13-1 Sc: 52.0 (filtered) best isotype model: Asn Sc: 89.2 >>>>>>>..>>>>............<<<<.>>>>...........<<<<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-1 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-2 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-3 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-4 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-5 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 .>>>>.>..>.>>............<<.<.>>>>>.........<<<<<................>>>>>.......<<<<<<.<<<<.. ATCTCCGTGGAGCAATTGGTtA...GCGCGTTCGGCTGTT..AACCGGAAA...........GtTGGTGGTTCGAGCCTACCCAGGGACG tRNA-Asn-GTT-15-1 Sc: 42.4 (filtered) best isotype model: Asn Sc: 86.4 >>>>>>>..>>>>............<<<<.>..>>.........<<..<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGTGCAATCGGTtA...GCGCGTTCGGCTGTT..AACCATAAG...........GtTGGTGGTTACAGACCACCCAGGGACG tRNA-Asn-GTT-18-1 Sc: 44.1 (filtered) best isotype model: Asn Sc: 82.0 .>>>>.>..>.>>............<<.<.>>>>>.........<<<<<................>>>>>.......<<<<<<.<<<<.. ATCTCCGTGGAGCAATTGGTtA...GCGCGTTCGGCCGTT..AACCGGAAA...........GtTGGTGGTTCGAGCCTACCCAGGGACG tRNA-Asn-GTT-19-1 Sc: 37.7 (filtered) best isotype model: Asn Sc: 78.0 >>>>>>>..>>.>............<.<<.>>>>>.........<<<<<.................>>.>.......<.<<.<<<<<<<. GTCTCTGTGGCGCAATCGGTcA...GAGCGTTCGGCTATT..AACCGAACG...........GtGAGTAGTTCAAGACCACCCAGGGACG tRNA-Asn-ATT-1-1 Sc: 47.8 (filtered) best isotype model: Asn Sc: 76.9 GTCTCTGTGGCGCAATCGGTcA...GAGCGTTCGGCTATT..AACCGAACG...........GtGAGTAGTTCAAGACCACCCAGGGACG tRNA-Asn-ATT-1-2 Sc: 47.8 (filtered) best isotype model: Asn Sc: 76.9 >>>>>>...>>.>............<.<<.>>.>>.........<<.<<................>>>>>.......<<<<<.<<<<<<. GTCTCTGTGGCACAATCGGTtA...GCGCGTTCGGCTGTT..AATCTAGAG...........GtTGGTGGTTAGAGCCCACTGAGGGATG tRNA-Asn-GTT-21-1 Sc: 42.4 (filtered) best isotype model: Asn Sc: 70.8 >>>>>>>..>>>>............<<<<.>>>>>.........<<<<<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGCGCCATCGGTtA...GTGCCTTCGGCTGTTtgAACCGAAAG...........GcTGGTGGTTCAAGCCCACCCAGAGATG tRNA-Asn-GTT-20-1 Sc: 41.0 (filtered) best isotype model: Asn Sc: 67.9 >>>>>.>..>>>>............<<<<.>>>>...........<<<<................>>>>>.......<<<<<<.<<<<<. GTTTCTGTAGCGCGATCGGTtA...GCGCCTTCGGCTGTT..AAACGAAAG...........GtTGGTGGTTCGTTCCCACCCCGGGACA tRNA-Asn-GTT-17-1 Sc: 39.0 (filtered) best isotype model: Asn Sc: 67.6 >>>>>>...>..>............<..<.>>.>>.........<<.<<................>>>>>.......<<<<<.<<<<<<. GTCTCTGTGGCACAATCGGTtA...GCTTGTTCGGCTGTT..AATCTAGAG...........GtTGGTGGTTAGAGCCCACTGAGGGATG tRNA-Asn-GTT-23-1 Sc: 30.4 (filtered) best isotype model: Asn Sc: 58.0 >>>>>>...>>.>............<.<<.>>.>>.........<<.<<................>>>>>.......<<<<<.<<<<<<. GTCTCTGTGGCACAATCGGTtA...GAGCGTTCGGCTGTT..AATCTAAAG...........GtTGGTGGCTAGAACCCACTGAGGGACG tRNA-Asn-GTT-22-1 Sc: 37.2 (filtered) best isotype model: Asn Sc: 57.6 >>>>>>>..>>>>............<<<<.>>>.>.........<.<<<................>.>>>.......<<<.<<<<<<<<. GTCTCTGTTGCGCAATC....A...GCGCGTTTGGCTGTT..AACAGAAAG...........GcTGGTGGTCCGAGCCCAACCAGGGACT tRX-Asn-NNN-1-1 Sc: 20.4 (filtered) best isotype model: Asn Sc: 52.5
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
0.348.791.02.4No Hit13.34.0-5.214.632.2No Hit35.244.3No HitNo HitNo Hit-11.940.222.4No Hit49.0-20.5
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo Hit-14.8No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
Expression Profiles