Gene: tRNA-Asp-GTC-2-6

Overview
Organism Homo sapiens
Locus chr6:27447453-27447524 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asp-GTC-2-6
HGNC Symbol TRD-GTC2-6
RNAcentral ID URS00006174C2_9606
tRNAscan-SE ID chr6.trna47
GtRNAdb 2009
Legacy Name and Score
chr6.trna45-AspGTC (72.92 bits)
Predicted tRNA Isotype / Anticodon Asp GTC
Top Scoring / Second Best Scoring Isotype Model Asp (109.9 bits) / Gly (76.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 10
Upstream / Downstream Sequence AGCTCCATTTTCACGTCAAT / GAGGCTTAAACTTTTTTTTA
Intron None
Possible Pseudogene No
Gene Score 66.5
Mature tRNA Score 66.5
HMM Score 35.70
Secondary Structure Score 30.80
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
TCCTCGTTAGTATAGTGGTgAGTATCCCCGCCTGTCACGCGGGAGaCCGGGGTTCGATTCCCCGACGGGGAG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAG
Alignments
Asp tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-1 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-10 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-11 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-2 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-3 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-4 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-5 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-6 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-7 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-8 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-9 Sc: 66.5 TCCTCGTTAGTATAGTGGTtA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCAATTCCCCGACGGGGAG tRNA-Asp-GTC-1-1 Sc: 65.4 TCCTCGTTAGTATAGTGGTgA.GTGTCCCCGTCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-3-1 Sc: 58.2
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>.......<<<<..<<<<<<<. TCCTCGTTAGTATGGTGGTgA.GTATCCCTGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCA.ACGGGGAG tRNA-Asp-GTC-4-1 Sc: 47.6 (filtered) best isotype model: Asp Sc: 92.3 >>>>>.>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<.<.<<<<<. TCCTCATCAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACTGGGGTTCGATTCCCTG.AGGAGGAG tRNA-Asp-GTC-5-1 Sc: 40.3 (filtered) best isotype model: Asp Sc: 82.2 >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<...............>>>>>.......<<<<<.<<<<<<<. TTCTTGTTAATATAGTGGTgA.GTATTCCCACCTGTCATGCGGGA............GACGGGGTTCAATTCCCTG.ATGGGGAG tRNA-Asp-GTC-6-1 Sc: 38.2 (filtered) best isotype model: Asp Sc: 68.8 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTgA.GTATCTCTGCCTGTCATGCGTGAG...........AGAGGGGGTCGATTCCCCG.ACGGGGAG tRNA-Asp-GTC-10-1 Sc: 23.5 (filtered) best isotype model: Asp Sc: 57.0 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>.>.......<.<<<.<<<<<<<. TCCTTGTTAGTATAGTGGTgA.GTGTTTCTGCCTGTCATGTGGAG............ACTGGAGTTTGAGTCCCCA.ACAGGGAG tRNA-Asp-GTC-8-1 Sc: 30.3 (filtered) best isotype model: Asp Sc: 53.6 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTaA.GTATCTCTGCCTGTCATGCATGAG...........AGAGGGGGTCGATTCCCTG.ACGGGGAG tRNA-Asp-GTC-9-1 Sc: 24.8 (filtered) best isotype model: Asp Sc: 53.0
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
45.145.021.3109.926.650.463.876.563.525.6No Hit13.045.2No Hit43.5-16.3No Hit56.037.926.940.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (10)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
5 (5′ Acceptor Stem)chr6:27447457rs546266921C / TNoYesGU base pair
19 (D-loop)chr6:27447470rs773731222G / CNoNouniversal base change
21 (D-loop)chr6:27447473rs562599428A / CNoYesuniversal base change
25 (3′ D-arm)chr6:27447477rs867015050T / CNoNorestore Watson-Crick base pair
30 (5′ Anticodon Stem)chr6:27447482rs531602106G / CNoYesbase pair mismatch
45 (Variable Loop)chr6:27447497rs541795958G / TNoYessubstitution in loop
48 (Variable Loop)chr6:27447499rs183424021C / GNoYessubstitution in loop
49 (5′ T-arm)chr6:27447500rs139428126C / TNoYesGU base pair
58 (T-Psi-C Loop)chr6:27447509rs777874562- / TNoNouniversal base change
73 (3′ end)chr6:27447524rs546505991G / ANoYessubstitution in loop
Expression Profiles