Gene: tRNA-Asp-GTC-2-7

Overview
Organism Homo sapiens
Locus chr6:27471523-27471594 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asp-GTC-2-7
HGNC Symbol TRD-GTC2-7
RNAcentral ID URS00006174C2_9606
tRNAscan-SE ID chr6.trna50
GtRNAdb 2009
Legacy Name and Score
chr6.trna48-AspGTC (72.92 bits)
Predicted tRNA Isotype / Anticodon Asp GTC
Top Scoring / Second Best Scoring Isotype Model Asp (109.9 bits) / Gly (76.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 10
Upstream / Downstream Sequence ACTCGCTGACGCAGAGTTCT / AAAAGTTGCTTTTTGCATCT
Intron None
Possible Pseudogene No
Gene Score 66.5
Mature tRNA Score 66.5
HMM Score 35.70
Secondary Structure Score 30.80
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
TCCTCGTTAGTATAGTGGTgAGTATCCCCGCCTGTCACGCGGGAGaCCGGGGTTCGATTCCCCGACGGGGAG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAG
Alignments
Asp tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-1 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-10 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-11 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-2 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-3 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-4 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-5 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-6 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-7 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-8 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-9 Sc: 66.5 TCCTCGTTAGTATAGTGGTtA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCAATTCCCCGACGGGGAG tRNA-Asp-GTC-1-1 Sc: 65.4 TCCTCGTTAGTATAGTGGTgA.GTGTCCCCGTCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-3-1 Sc: 58.2
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>.......<<<<..<<<<<<<. TCCTCGTTAGTATGGTGGTgA.GTATCCCTGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCA.ACGGGGAG tRNA-Asp-GTC-4-1 Sc: 47.6 (filtered) best isotype model: Asp Sc: 92.3 >>>>>.>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<.<.<<<<<. TCCTCATCAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACTGGGGTTCGATTCCCTG.AGGAGGAG tRNA-Asp-GTC-5-1 Sc: 40.3 (filtered) best isotype model: Asp Sc: 82.2 >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<...............>>>>>.......<<<<<.<<<<<<<. TTCTTGTTAATATAGTGGTgA.GTATTCCCACCTGTCATGCGGGA............GACGGGGTTCAATTCCCTG.ATGGGGAG tRNA-Asp-GTC-6-1 Sc: 38.2 (filtered) best isotype model: Asp Sc: 68.8 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTgA.GTATCTCTGCCTGTCATGCGTGAG...........AGAGGGGGTCGATTCCCCG.ACGGGGAG tRNA-Asp-GTC-10-1 Sc: 23.5 (filtered) best isotype model: Asp Sc: 57.0 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>.>.......<.<<<.<<<<<<<. TCCTTGTTAGTATAGTGGTgA.GTGTTTCTGCCTGTCATGTGGAG............ACTGGAGTTTGAGTCCCCA.ACAGGGAG tRNA-Asp-GTC-8-1 Sc: 30.3 (filtered) best isotype model: Asp Sc: 53.6 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTaA.GTATCTCTGCCTGTCATGCATGAG...........AGAGGGGGTCGATTCCCTG.ACGGGGAG tRNA-Asp-GTC-9-1 Sc: 24.8 (filtered) best isotype model: Asp Sc: 53.0
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
45.145.021.3109.926.650.463.876.563.525.6No Hit13.045.2No Hit43.5-16.3No Hit56.037.926.940.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (22)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
2 (5′ Acceptor Stem)chr6:27471524rs540977473C / TNoNoGU base pair
5 (5′ Acceptor Stem)chr6:27471527rs143045980C / TNoYesGU base pair
9 (Acceptor-D-arm-linker)chr6:27471531rs545227769A / GNoYessubstitution in loop
21 (D-loop)chr6:27471543rs372800059A / CNoYesuniversal base change
25 (3′ D-arm)chr6:27471547rs530683940T / ANoYesbase pair mismatch
26 (D-arm-Anticodon-linker)chr6:27471548rs185973452C / TNoYessubstitution in loop
30 (5′ Anticodon Stem)chr6:27471552rs560930519G / ANoYesbase pair mismatch
33 (Anticodon Loop)chr6:27471555rs761950324T / CNoNouniversal base change
34 (Anticodon Loop)chr6:27471556rs769905672G / ANoNosynonymous anticodon change
37 (Anticodon Loop)chr6:27471559rs773690063A / GNoNosubstitution in loop
38 (Anticodon Loop)chr6:27471560rs376240576C / GNoYessubstitution in loop
38 (Anticodon Loop)chr6:27471560rs376240576C / TNoYessubstitution in loop
42 (3′ Anticodon Stem)chr6:27471564rs755929855G / ANoNobase pair mismatch
43 (3′ Anticodon Stem)chr6:27471565rs546599108G / ANoYesbase pair mismatch
49 (5′ T-arm)chr6:27471570rs567202548C / GNoYesbase pair mismatch
53 (5′ T-arm)chr6:27471574rs532687276G / ANoYesbase pair mismatch
67 (3′ Acceptor Stem)chr6:27471588rs763468849C / TNoNoGU base pair
68 (3′ Acceptor Stem)chr6:27471589rs547739264G / CNoNobase pair mismatch
69 (3′ Acceptor Stem)chr6:27471590rs60371651G / ANoYesrestore Watson-Crick base pair
69 (3′ Acceptor Stem)chr6:27471590rs60371651G / CNoYesbase pair mismatch
71 (3′ Acceptor Stem)chr6:27471592rs569356375G / ANoYesbase pair mismatch
73 (3′ end)chr6:27471594rs538023390G / ANoYessubstitution in loop
Expression Profiles