Gene: tRNA-Glu-CTC-2-1

Overview
Organism Homo sapiens
Locus chr1:249168447-249168518 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Glu-CTC-2-1
HGNC Symbol TRE-CTC2-1
RNAcentral ID URS0000635088_9606
tRNAscan-SE ID chr1.trna57
GtRNAdb 2009
Legacy Name and Score
chr1.trna59-GluCTC (71.50 bits)
Predicted tRNA Isotype / Anticodon Glu CTC
Top Scoring / Second Best Scoring Isotype Model Glu (106.3 bits) / Asp (87.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 16
Upstream / Downstream Sequence CTAAATGACGCATCATGTCT / GTAAGCCGTTTTAAAAACTG
Intron None
Possible Pseudogene No
Gene Score 68.7
Mature tRNA Score 68.7
HMM Score 47.40
Secondary Structure Score 21.30
Atypical Features C2:A71
Known Modifications (Modomics) m2G10 Ψ13 D20 Ψ20a m5C49 m5C50 m5Um54 Ψ55
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
TCCCTGGTGGTCTAGTGGTtAGGATTCGGCGCTCTCACCGCCGCGGCCCGGGTTCGATTCCCGGTCAGGAAA
Secondary Structure (nested bp)
>.>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<.<.
Predicted Mature tRNA
UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGCUCUCACCGCCGCGGCCCGGGUUCGAUUCCCGGUCAGGAAA
Alignments
Glu tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-1 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-2 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-3 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-4 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-5 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-6 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-7 Sc: 73.2 >.>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<.<.... TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGAAA... tRNA-Glu-CTC-2-1 Sc: 68.7 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAAcca RE9990_CTC_HUMAN_CY >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... TCCCATATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGTG...........GCCCGGGTTCGACTCCCGGTATGGGAA... tRNA-Glu-TTC-1-1 Sc: 72.5 TCCCATATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGTG...........GCCCGGGTTCGACTCCCGGTATGGGAA... tRNA-Glu-TTC-1-2 Sc: 72.5 TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGCCAGGGAA... tRNA-Glu-TTC-3-1 Sc: 71.6 TCCCACATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGCG...........GCCCGGGTTCGACTCCCGGTGTGGGAA... tRNA-Glu-TTC-2-1 Sc: 71.2 TCCCACATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGCG...........GCCCGGGTTCGACTCCCGGTGTGGGAA... tRNA-Glu-TTC-2-2 Sc: 71.2 TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-TTC-4-1 Sc: 68.7 TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-TTC-4-2 Sc: 68.7 >.>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<.<.... TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........CCCCGGGTTCGATTCCCGGCCAGGAAT... DE9990_TTC_HUMAN_CY TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGAAT... DE9991_TTC_HUMAN_CY
>.>..>....>>>....>.....>>>>.........<<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<<<<<..... T.C..C....CTG....GTG...GTCTAGTGGCtA.GGATTCGGCG.CTTT.CAC.CGCCtGCA...........G.CTCGAGTTCGATTCCTGG....TCAGGGAA.... tRNA-Glu-TTC-8-1 Sc: 35.9 (filtered) best isotype model: Glu Sc: 80.9 >.>..>.....>>....>.....>>>>.........<<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<.<<<..... T.C..C....GTG....GTG...GTCTAGTGGCtA.GGATTCGGCG.CTTT.CAC.CGCCtGCA...........G.CTCGAGTTCGATTCCTGG....TCAGGGAA.... tRNA-Glu-TTC-10-1 Sc: 28.2 (filtered) best isotype model: Glu Sc: 73.6 >....>....>>>....>.....>>>...........<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<<<.<..... T.G..T....CTG....GTG...GTCAAGTGGCtA.GGATTTGGCG.CTTT.CAC.TGCC.GCG...........G.CCCGCGTTCGATTCCCGG....TCAGGGAA.... tRNA-Glu-TTC-7-1 Sc: 31.5 (filtered) best isotype model: Glu Sc: 72.3 >.>..>....>>.....>.....>>>>.........<<<<.>>..>..........<..<.<.................>>>>.......<<<<.....<.<<<<<..... T.C..C....TTG....GTG...GTCTAGTGGCtA.GGATTCGGTG.CTTT.CAC.CTGT.GCG...........G.CCCGGGTTCAATTCCCGA....TGAAGGAA.... tRNA-Glu-TTC-6-1 Sc: 36.6 (filtered) best isotype model: Glu Sc: 70.7 >.>..>....>>>....>.....>>>>.........<<<<..>>>>..........<<<<..................>>>>>.......<<<<<....<<<<<<<..... T.C..CgcatCTGc...ATGgttGTCTAGTGGCtA.GGATTCGGTG.CTGA.AAG.CGTC.ACG...........G.CCCGGGTTCGATTCCCGG....TCAGGGAA.... tRNA-Phe-GAA-10-1 Sc: 26.6 (filtered) best isotype model: Glu Sc: 68.8 >.>..>....>>>....>.....>>>>.........<<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<<<<<..... TcC..C....CTG....GTG...GTCTAGTGCTtA.GGATTCGGTG.CTCT.CAC.CGCT.GCT...........G.CCTGCGTTCGATTCCCGG....TCAGGGAA.... tRNA-Glu-CTC-3-1 Sc: 33.8 (filtered) best isotype model: Glu Sc: 68.2 >.>..>....>>>....>.....>>>>.........<<<<..>>>............<<<..................>>>>>.......<<<<<....<<<<<<<..... T.C..CgcatCTGc...ATGgttGTCTAGTGGCtA.GGATTCGGTG.CTGA.AAG.AGCC.ACG...........G.CCCGGGTTCGATTCCCGG....TCAGGGAA.... tRNA-Phe-GAA-9-1 Sc: 24.3 (filtered) best isotype model: Glu Sc: 64.4 >.>..>....>>>....>.....>>>>.........<<<<..>>.>..........<.<<..................>>>>>.......<<<<<....<<<<<<<..... T.C..C....CTG....GTA...GTCTAGTGGTtA.GGATTCCGCG.CTCGcCAT.CACG..A..............CCCGGGTTCGATTCCTGG....TCAGGGAA.... tRNA-Und-NNN-4-1 Sc: 43.0 (filtered) best isotype model: Glu Sc: 63.3 >....>....>>>....>.....>>>>.........<<<<.>>.>>..........<<.<.<................>>.>>.......<<.<<....<<<<<.<..... T.C..C....CTG....GTG...GTCTAGTGGCtA.GGATTCTAGTgCTTT.AACtGCCA.GC............G.CCCAGGTTCAATTCCCGG....TTAGGAAA.... tRNA-Und-NNN-3-1 Sc: 36.3 (filtered) best isotype model: Glu Sc: 61.9 >......................>>>>.........<<<<.>.>>>..........<<<..<................>>>>>.......<<<<<..........<..... G.................TG...GTCTAGTGGTtA.GGATTCAGCG.CTCC.CAC.CGCC.GCA...........G.CCCGGGTTCGATTCCCGG....T.....CA.... tRNA-Gly-CCC-7-1 Sc: 36.5 (filtered) best isotype model: Glu Sc: 60.5 ..>..>....>>>....>.....>..>.........<..<.>>>>>..........<<<<.<................>>>>>.......<<<<<....<<<<<<...... C.C..C....CTG....GTG...ATCTAGTGGTtA.GTCTTTGGCG.CTCT.CAC.TGCC.ACT...........A.CCCGGGTTTGATTTCCGG....TCAGGGAA.... tRX-Glu-NNN-1-1 Sc: 21.9 (filtered) best isotype model: Glu Sc: 54.1 >.>..>....>>>....>.....>>>>.........<<<<.>>>..............<<.<................>>>.>.......<.<<<....<<<<<<<..... TcC..C....CTG....GTG...GTCTAGTGCTtA.GGATTTGGCA.CTCT.CGC.CACC.GCA...........G.CCTGCGTTCAATTCCCGG....TCAGGGAA.... tRNA-Glu-CTC-7-1 Sc: 21.4 (filtered) best isotype model: Glu Sc: 53.7 >....>....>>>....>.....>>>>.........<<<<.>.>>>..........<<<..<................>>.>>.......<<.<<....<<<<<.<..... T.CcaC....CCT....GTG...GTCTAGTGGCtA.AGACTTTGTG.CTTT.CAT.TGCT.GC............AtCCTAGGTTCAATTCCCAG.t..CAGGGAAG.... tRNA-Glu-TTC-11-1 Sc: 21.5 (filtered) best isotype model: Glu Sc: 49.3 >.>..>....>>>....>.....>>>>.........<<<<.>.>>>..........<<<..<................>>>>>.......<<<<<....<<<<<<<..... T.C..C....TTG....AT....GTCTAGTGGTtA.GGATTTGGTG.CTCT.CAC.TGCA.GCA...........G.CCTGGGTTCATTTCTCAG....TCAGGGAA.... tRNA-Glu-CTC-5-1 Sc: 22.8 (filtered) best isotype model: Glu Sc: 49.2 ..>..>....>>...........>>.>.........<.<<..>>>>..........<<<<..................>>>>>.......<<<<<......<<<<...... G.C..C....TG......TG...GTCTAGTGGTtA.GAATTCAGTG.TTTT.CAG.TGCT.CTA...........G.TCCAGGTTCAATTCCTGG....T.CAGGGAacca tRNA-Glu-TTC-13-1 Sc: 21.3 (filtered) best isotype model: Glu Sc: 33.6 >.>..>....>.>....>......>>>.........<<<..>.>>>..........<<<..<................>>>>>.......<<<<<....<<.<<<<..... T.C..T....CCAccctGTG...GTCTAGTGGTtA.GGAGTTGGTG.CTTT.CGT.CATG.ACA...........G.CCCAGGTTCAATTCCTGG....TTAGAGAG.... tRNA-Glu-TTC-12-1 Sc: 24.5 (filtered) best isotype model: Glu Sc: 31.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
38.342.613.287.123.551.4106.379.677.549.814.09.219.8No Hit35.0No Hit3.943.536.514.542.2No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (38)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr1:249168447rs78345543T / GNoYesbase pair mismatch
4 (5′ Acceptor Stem)chr1:249168450rs537481753C / GNoYesbase pair mismatch
4 (5′ Acceptor Stem)chr1:249168450rs537481753C / TNoYesGU base pair
11 (5′ D-arm)chr1:249168457rs143430070T / CNoYesbase pair mismatch
12 (5′ D-arm)chr1:249168458rs571010687C / GNoYesbase pair mismatch
12 (5′ D-arm)chr1:249168458rs571010687C / TNoYesGU base pair
14 (D-loop)chr1:249168460rs757703724A / GNoNouniversal base change
19 (D-loop)chr1:249168464rs538816429G / ANoYesuniversal base change
21 (D-loop)chr1:249168467rs191613871A / GNoYesuniversal base change
23 (3′ D-arm)chr1:249168469rs566920437G / ANoYesbase pair mismatch
24 (3′ D-arm)chr1:249168470rs763135739A / GNoNoGU base pair
27 (5′ Anticodon Stem)chr1:249168473rs543304094C / TNoYesGU base pair
28 (5′ Anticodon Stem)chr1:249168474rs555006084G / ANoYesbase pair mismatch
30 (5′ Anticodon Stem)chr1:249168476rs528004350C / TNoYesGU base pair
31 (5′ Anticodon Stem)chr1:249168477rs543456264G / ANoYesbase pair mismatch
32 (Anticodon Loop)chr1:249168478rs565350968C / TNoYessubstitution in loop
34 (Anticodon Loop)chr1:249168480rs748774235C / TNoNosynonymous anticodon change
37 (Anticodon Loop)chr1:249168483rs532668556A / TNoYessubstitution in loop
39 (3′ Anticodon Stem)chr1:249168485rs750185681C / TNoNoGU base pair
41 (3′ Anticodon Stem)chr1:249168487rs746923616C / -NoNobulge in stem
42 (3′ Anticodon Stem)chr1:249168488rs756136691C / TNoNoGU base pair
44 (Variable Loop)chr1:249168490rs552356830C / GNoYessubstitution in loop
46 (Variable Loop)chr1:249168492rs560366242G / ANoYessubstitution in loop
46 (Variable Loop)chr1:249168492rs560366242G / TNoYessubstitution in loop
49 (5′ T-arm)chr1:249168494rs747966908C / GNoNobase pair mismatch
50 (5′ T-arm)chr1:249168495rs527528780C / GNoYesbase pair mismatch
50 (5′ T-arm)chr1:249168495rs527528780C / TNoYesGU base pair
52 (5′ T-arm)chr1:249168497rs552862504G / CNoNobase pair mismatch
53 (5′ T-arm)chr1:249168498rs766243735- / TNoNorepair bulge
55 (T-Psi-C Loop)chr1:249168500rs549249751T / CNoYesuniversal base change
56 (T-Psi-C Loop)chr1:249168501rs567456338C / TNoYesuniversal base change
57 (T-Psi-C Loop)chr1:249168502rs570860946G / ANoYessubstitution in loop
57 (T-Psi-C Loop)chr1:249168502rs570860946G / CNoYessubstitution in loop
58 (T-Psi-C Loop)chr1:249168503rs183759740A / GNoYesuniversal base change
64 (3′ T-arm)chr1:249168509rs570972185G / CNoYesbase pair mismatch
66 (3′ Acceptor Stem)chr1:249168511rs772877454T / CNoNorestore Watson-Crick base pair
67 (3′ Acceptor Stem)chr1:249168512rs538328514C / TNoYesGU base pair
71 (3′ Acceptor Stem)chr1:249168516rs6672727A / GNoYesrepair mismatch
Expression Profiles