Gene: tRNA-Glu-TTC-3-1

Overview
Organism Homo sapiens
Locus chr1:17199078-17199149 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Glu-TTC-3-1
HGNC Symbol TRE-TTC3-1
RNAcentral ID URS000064074C_9606
tRNAscan-SE ID chr1.trna5
GtRNAdb 2009
Legacy Name and Score
chr1.trna5-GluTTC (75.96 bits)
Predicted tRNA Isotype / Anticodon Glu TTC
Top Scoring / Second Best Scoring Isotype Model Glu (113.5 bits) / Asp (90.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 13
Upstream / Downstream Sequence ACAAAGCTCCCTCCTGTGTG / TTGTTTTACACTGGCCGCCC
Intron None
Possible Pseudogene No
Gene Score 71.6
Mature tRNA Score 71.6
HMM Score 44.70
Secondary Structure Score 26.90
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
TCCCTGGTGGTCTAGTGGCtAGGATTCGGCGCTTTCACCGCCGCGGCCCGGGTTCGATTCCCGGCCAGGGAA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
UCCCUGGUGGUCUAGUGGCUAGGAUUCGGCGCUUUCACCGCCGCGGCCCGGGUUCGAUUCCCGGCCAGGGAA
Alignments
Glu tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-1 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-2 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-3 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-4 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-5 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-6 Sc: 73.2 TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-CTC-1-7 Sc: 73.2 >.>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<.<.... TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGAAA... tRNA-Glu-CTC-2-1 Sc: 68.7 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... TCCCTGGTGGTCTAGTGGTtA.GGATTCGGCGCTCTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAAcca RE9990_CTC_HUMAN_CY >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... TCCCATATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGTG...........GCCCGGGTTCGACTCCCGGTATGGGAA... tRNA-Glu-TTC-1-1 Sc: 72.5 TCCCATATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGTG...........GCCCGGGTTCGACTCCCGGTATGGGAA... tRNA-Glu-TTC-1-2 Sc: 72.5 TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGCCAGGGAA... tRNA-Glu-TTC-3-1 Sc: 71.6 TCCCACATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGCG...........GCCCGGGTTCGACTCCCGGTGTGGGAA... tRNA-Glu-TTC-2-1 Sc: 71.2 TCCCACATGGTCTAGCGGTtA.GGATTCCTGGTTTTCACCCAGGCG...........GCCCGGGTTCGACTCCCGGTGTGGGAA... tRNA-Glu-TTC-2-2 Sc: 71.2 TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-TTC-4-1 Sc: 68.7 TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGGAA... tRNA-Glu-TTC-4-2 Sc: 68.7 >.>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<.<.... TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........CCCCGGGTTCGATTCCCGGCCAGGAAT... DE9990_TTC_HUMAN_CY TCCCTGGTGGTCTAGTGGCtA.GGATTCGGCGCTTTCACCGCCGCG...........GCCCGGGTTCGATTCCCGGTCAGGAAT... DE9991_TTC_HUMAN_CY
>.>..>....>>>....>.....>>>>.........<<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<<<<<..... T.C..C....CTG....GTG...GTCTAGTGGCtA.GGATTCGGCG.CTTT.CAC.CGCCtGCA...........G.CTCGAGTTCGATTCCTGG....TCAGGGAA.... tRNA-Glu-TTC-8-1 Sc: 35.9 (filtered) best isotype model: Glu Sc: 80.9 >.>..>.....>>....>.....>>>>.........<<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<.<<<..... T.C..C....GTG....GTG...GTCTAGTGGCtA.GGATTCGGCG.CTTT.CAC.CGCCtGCA...........G.CTCGAGTTCGATTCCTGG....TCAGGGAA.... tRNA-Glu-TTC-10-1 Sc: 28.2 (filtered) best isotype model: Glu Sc: 73.6 >....>....>>>....>.....>>>...........<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<<<.<..... T.G..T....CTG....GTG...GTCAAGTGGCtA.GGATTTGGCG.CTTT.CAC.TGCC.GCG...........G.CCCGCGTTCGATTCCCGG....TCAGGGAA.... tRNA-Glu-TTC-7-1 Sc: 31.5 (filtered) best isotype model: Glu Sc: 72.3 >.>..>....>>.....>.....>>>>.........<<<<.>>..>..........<..<.<.................>>>>.......<<<<.....<.<<<<<..... T.C..C....TTG....GTG...GTCTAGTGGCtA.GGATTCGGTG.CTTT.CAC.CTGT.GCG...........G.CCCGGGTTCAATTCCCGA....TGAAGGAA.... tRNA-Glu-TTC-6-1 Sc: 36.6 (filtered) best isotype model: Glu Sc: 70.7 >.>..>....>>>....>.....>>>>.........<<<<..>>>>..........<<<<..................>>>>>.......<<<<<....<<<<<<<..... T.C..CgcatCTGc...ATGgttGTCTAGTGGCtA.GGATTCGGTG.CTGA.AAG.CGTC.ACG...........G.CCCGGGTTCGATTCCCGG....TCAGGGAA.... tRNA-Phe-GAA-10-1 Sc: 26.6 (filtered) best isotype model: Glu Sc: 68.8 >.>..>....>>>....>.....>>>>.........<<<<.>>>>>..........<<<<.<................>>>.>.......<.<<<....<<<<<<<..... TcC..C....CTG....GTG...GTCTAGTGCTtA.GGATTCGGTG.CTCT.CAC.CGCT.GCT...........G.CCTGCGTTCGATTCCCGG....TCAGGGAA.... tRNA-Glu-CTC-3-1 Sc: 33.8 (filtered) best isotype model: Glu Sc: 68.2 >.>..>....>>>....>.....>>>>.........<<<<..>>>............<<<..................>>>>>.......<<<<<....<<<<<<<..... T.C..CgcatCTGc...ATGgttGTCTAGTGGCtA.GGATTCGGTG.CTGA.AAG.AGCC.ACG...........G.CCCGGGTTCGATTCCCGG....TCAGGGAA.... tRNA-Phe-GAA-9-1 Sc: 24.3 (filtered) best isotype model: Glu Sc: 64.4 >.>..>....>>>....>.....>>>>.........<<<<..>>.>..........<.<<..................>>>>>.......<<<<<....<<<<<<<..... T.C..C....CTG....GTA...GTCTAGTGGTtA.GGATTCCGCG.CTCGcCAT.CACG..A..............CCCGGGTTCGATTCCTGG....TCAGGGAA.... tRNA-Und-NNN-4-1 Sc: 43.0 (filtered) best isotype model: Glu Sc: 63.3 >....>....>>>....>.....>>>>.........<<<<.>>.>>..........<<.<.<................>>.>>.......<<.<<....<<<<<.<..... T.C..C....CTG....GTG...GTCTAGTGGCtA.GGATTCTAGTgCTTT.AACtGCCA.GC............G.CCCAGGTTCAATTCCCGG....TTAGGAAA.... tRNA-Und-NNN-3-1 Sc: 36.3 (filtered) best isotype model: Glu Sc: 61.9 >......................>>>>.........<<<<.>.>>>..........<<<..<................>>>>>.......<<<<<..........<..... G.................TG...GTCTAGTGGTtA.GGATTCAGCG.CTCC.CAC.CGCC.GCA...........G.CCCGGGTTCGATTCCCGG....T.....CA.... tRNA-Gly-CCC-7-1 Sc: 36.5 (filtered) best isotype model: Glu Sc: 60.5 ..>..>....>>>....>.....>..>.........<..<.>>>>>..........<<<<.<................>>>>>.......<<<<<....<<<<<<...... C.C..C....CTG....GTG...ATCTAGTGGTtA.GTCTTTGGCG.CTCT.CAC.TGCC.ACT...........A.CCCGGGTTTGATTTCCGG....TCAGGGAA.... tRX-Glu-NNN-1-1 Sc: 21.9 (filtered) best isotype model: Glu Sc: 54.1 >.>..>....>>>....>.....>>>>.........<<<<.>>>..............<<.<................>>>.>.......<.<<<....<<<<<<<..... TcC..C....CTG....GTG...GTCTAGTGCTtA.GGATTTGGCA.CTCT.CGC.CACC.GCA...........G.CCTGCGTTCAATTCCCGG....TCAGGGAA.... tRNA-Glu-CTC-7-1 Sc: 21.4 (filtered) best isotype model: Glu Sc: 53.7 >....>....>>>....>.....>>>>.........<<<<.>.>>>..........<<<..<................>>.>>.......<<.<<....<<<<<.<..... T.CcaC....CCT....GTG...GTCTAGTGGCtA.AGACTTTGTG.CTTT.CAT.TGCT.GC............AtCCTAGGTTCAATTCCCAG.t..CAGGGAAG.... tRNA-Glu-TTC-11-1 Sc: 21.5 (filtered) best isotype model: Glu Sc: 49.3 >.>..>....>>>....>.....>>>>.........<<<<.>.>>>..........<<<..<................>>>>>.......<<<<<....<<<<<<<..... T.C..C....TTG....AT....GTCTAGTGGTtA.GGATTTGGTG.CTCT.CAC.TGCA.GCA...........G.CCTGGGTTCATTTCTCAG....TCAGGGAA.... tRNA-Glu-CTC-5-1 Sc: 22.8 (filtered) best isotype model: Glu Sc: 49.2 ..>..>....>>...........>>.>.........<.<<..>>>>..........<<<<..................>>>>>.......<<<<<......<<<<...... G.C..C....TG......TG...GTCTAGTGGTtA.GAATTCAGTG.TTTT.CAG.TGCT.CTA...........G.TCCAGGTTCAATTCCTGG....T.CAGGGAacca tRNA-Glu-TTC-13-1 Sc: 21.3 (filtered) best isotype model: Glu Sc: 33.6 >.>..>....>.>....>......>>>.........<<<..>.>>>..........<<<..<................>>>>>.......<<<<<....<<.<<<<..... T.C..T....CCAccctGTG...GTCTAGTGGTtA.GGAGTTGGTG.CTTT.CGT.CATG.ACA...........G.CCCAGGTTCAATTCCTGG....TTAGAGAG.... tRNA-Glu-TTC-12-1 Sc: 24.5 (filtered) best isotype model: Glu Sc: 31.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
42.850.520.390.524.362.5113.582.883.454.921.612.228.8No Hit47.8No Hit4.654.343.720.748.7No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (12)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
6 (5′ Acceptor Stem)chr1:17199083rs558994459G / CNoYesbase pair mismatch
9 (Acceptor-D-arm-linker)chr1:17199086rs572365713G / ANoYessubstitution in loop
43 (3′ Anticodon Stem)chr1:17199120rs868403249G / CNoNobase pair mismatch
46 (Variable Loop)chr1:17199123rs12047619G / CNoYessubstitution in loop
48 (Variable Loop)chr1:17199124rs555217634C / TNoYessubstitution in loop
49 (5′ T-arm)chr1:17199125rs572537094C / TNoYesGU base pair
50 (5′ T-arm)chr1:17199126rs543644360C / TNoYesGU base pair
51 (5′ T-arm)chr1:17199127rs868853171G / ANoNobase pair mismatch
57 (T-Psi-C Loop)chr1:17199133rs9435677G / ANoNosubstitution in loop
65 (3′ T-arm)chr1:17199141rs563531853G / ANoYesbase pair mismatch
66 (3′ Acceptor Stem)chr1:17199142rs10887999C / TYesNoGU base pair
69 (3′ Acceptor Stem)chr1:17199145rs868298909G / ANoNobase pair mismatch
Expression Profiles