Gene: tRNA-Gly-TCC-4-1

Overview
Organism Homo sapiens
Locus chr1:161409961-161410032 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Gly-TCC-4-1
HGNC Symbol TRG-TCC4-1
RNAcentral ID URS000068668E_9606
tRNAscan-SE ID chr1.trna80
GtRNAdb 2009
Legacy Name and Score
chr1.trna82-GlyTCC (55.96 bits)
Predicted tRNA Isotype / Anticodon Gly TCC
Top Scoring / Second Best Scoring Isotype Model Gly (86.4 bits) / His (48.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 4 out of 6
Upstream / Downstream Sequence GGGGCTGCCCGCGCCGTGCG / TCGGGCGGACCTTTTGCGGA
Intron None
Possible Pseudogene No
Gene Score 56.0
Mature tRNA Score 56.0
HMM Score 41.50
Secondary Structure Score 14.50
Atypical Features A12:C23 C49:C65 C54
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GCGTTGGTGGTATAGTGGTgAGCATAGTTGCCTTCCAAGCAGTTGaCCCGGGCTCGATTCCCGCCCAACGCA
Secondary Structure (nested bp)
>>>>>>>..>>.>........<.<<.>>>>>.......<<<<<.....>>>>.......<<<<.<<<<<<<.
Predicted Mature tRNA
GCGUUGGUGGUAUAGUGGUGAGCAUAGUUGCCUUCCAAGCAGUUGACCCGGGCUCGAUUCCCGCCCAACGCA
Alignments
Gly tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... tRNA-Gly-GCC-2-1 Sc: 81.0 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... tRNA-Gly-GCC-2-2 Sc: 81.0 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... tRNA-Gly-GCC-2-3 Sc: 81.0 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... tRNA-Gly-GCC-2-4 Sc: 81.0 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... tRNA-Gly-GCC-2-5 Sc: 81.0 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... tRNA-Gly-GCC-2-6 Sc: 81.0 GCATGGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCCATGCA... tRNA-Gly-GCC-1-1 Sc: 80.9 GCATGGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCCATGCA... tRNA-Gly-GCC-1-2 Sc: 80.9 GCATGGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCCATGCA... tRNA-Gly-GCC-1-3 Sc: 80.9 GCATGGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCCATGCA... tRNA-Gly-GCC-1-4 Sc: 80.9 GCATGGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCCATGCA... tRNA-Gly-GCC-1-5 Sc: 80.9 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTTGATTCCCGGCCAGTGCA... tRNA-Gly-GCC-3-1 Sc: 75.0 >>>>.>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<.<<<<.... GCATAGGTGGTTCAGTGGT.A.GAATTCTTGCCTGCCACGCAGGAG...........GCCCAGGTTTGATTCCTGGCCCATGCA... tRNA-Gly-GCC-4-1 Sc: 69.4 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>.>>.........<<.<<<<<<<<.... GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCATGCGGGCG...........GCCGGGCTTCGATTCCTGGCCAATGCA... tRNA-Gly-GCC-5-1 Sc: 54.7 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCA... DG9990_GCC_HUMAN_CY GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTGCCACGCGGGAG...........GCCCGGGTTCGATTCCCGGCCAATGCAcca RG9991_GCC_HUMAN_PLACENTA >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTCCCACGCGGGAG...........ACCCGGGTTCAATTCCCGGCCAATGCA... tRNA-Gly-CCC-1-1 Sc: 78.3 GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTCCCACGCGGGAG...........ACCCGGGTTCAATTCCCGGCCAATGCA... tRNA-Gly-CCC-1-2 Sc: 78.3 >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCGCCGCTGGTGTAGTGGT.A.TCATGCAAGATTCCCATTCTTGCG...........ACCCGGGTTCGATTCCCGGGCGGCGCA... tRNA-Gly-CCC-2-1 Sc: 75.1 GCGCCGCTGGTGTAGTGGT.A.TCATGCAAGATTCCCATTCTTGCG...........ACCCGGGTTCGATTCCCGGGCGGCGCA... tRNA-Gly-CCC-2-2 Sc: 75.1 >>>>>>>..>>>>.........<<<<.>>.>>.......<<.<<...............>>>>>.......<<<<<<<<<<<<.... GCATTGGTGGTTCAATGGT.A.GAATTCTCGCCTCCCACGCAGGAG...........ACCCAGGTTCGATTCCTGGCCAATGCA... tRNA-Gly-CCC-3-1 Sc: 68.3 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCATTGGTGGTTCAGTGGT.A.GAATTCTCGCCTCCCACGCGGGAG...........ACCCGGGTTCAATTCCCGGCCAATGCA... DG9991_CCC_HUMAN_CY >>>>>>>..>>>...........<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCGCCGCTGGTGTAGTGGT.A.TCATGCAAGATTCCCATTCTTGCG...........ACCCGGGTTCGATTCCCGGGCGGCGCAcca RG9990_CCC_HUMAN_PLACENTA >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCGTTGGTGGTATAGTGGTtA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-1-1 Sc: 73.8 GCGTTGGTGGTATAGTGGTgA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-2-1 Sc: 73.8 GCGTTGGTGGTATAGTGGTgA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-2-2 Sc: 73.8 GCGTTGGTGGTATAGTGGTgA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-2-3 Sc: 73.8 GCGTTGGTGGTATAGTGGTgA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-2-4 Sc: 73.8 GCGTTGGTGGTATAGTGGTgA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-2-5 Sc: 73.8 GCGTTGGTGGTATAGTGGTgA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-2-6 Sc: 73.8 GCGTTGGTGGTATAGTGGTaA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... tRNA-Gly-TCC-3-1 Sc: 73.8 >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<................>>>>.......<<<<.<<<<<<<.... GCGTTGGTGGTATAGTGGTgA.GCATAGTTGCCTTCCAAGCAGTTG...........ACCCGGGCTCGATTCCCGCCCAACGCA... tRNA-Gly-TCC-4-1 Sc: 56.0 >>>>>>>..>>.>.........<.<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<.... GCGTTGGTGGTATAGTGGTtA.GCATAGCTGCCTTCCAAGCAGTTG...........ACCCGGGTTCGATTCCCGGCCAACGCA... DG9992_TCC_HUMAN_CY
>>>..>>>..>>>>............<<<<.>>>>>.........<.<<<<.................>>>>>.......<<<<<.........<<<.<<<... GCG.TTGGTGGTTT.AGTGGT..A..GAATTCTCGCCTCC.CAT.G.CGGGAG.............ACCCGGGTTCAATTCCCGG.........CCACTGCA.. tRNA-Gly-CCC-4-1 Sc: 65.7 (filtered) best isotype model: Gly Sc: 95.5 >>...>>>..>>>>............<<<<.>>>>>.........<.<<<<.................>>>>>.......<<<<<.........<<<..<<... GCA.CTGGTGGTTC.AGTGGT..A..GAATTCTCGCCTCA.CAC.G.CGGGAC.............ACCCGGGTTCAATTCCCGG.........TCAAGGCA.. tRNA-Val-CAC-8-1 Sc: 60.1 (filtered) best isotype model: Gly Sc: 86.3 >>..>>>>..>>.>............<.<<.>>>>>.........<.<<<<.................>>>>>.......<<<<<.........<<<<.<<... GCC.TTGGTGGTGC.AGTGGT..A..GAATTCTCGCCTCC.CAC.G.TGGGAG.............ACCCGGGTTCAATTCCCGG.........CCAATGCA.. tRNA-Gly-CCC-5-1 Sc: 56.3 (filtered) best isotype model: Gly Sc: 86.0 >....>>>..>>>>............<<<<.>>>>>.........<.<<<<.................>>>>>.......<<<<<.........<<<...<... GCA.CTGGTGGTTC.AGTGGT..A..GAATTCTCGCCTCC.CAC.G.CGGGAG.............ACCCGGGTTTAATTCCCGG.........TCAAGATA.. tRNA-Gly-CCC-6-1 Sc: 51.6 (filtered) best isotype model: Gly Sc: 78.2 >>>.>>>>..>>>>............<<<<.>>..>.........<...<<.................>>>>>.......<<<<<.........<<<<<<<... GCA.TGGGTGATTC.AGTGGT..A..GAATTTTCACCTGC.CAT.G.CAGGAG.............GTCCAGGTTCATTTCCTGG.........CCTATGCA.. tRNA-Gly-GCC-6-1 Sc: 48.7 (filtered) best isotype model: Gly Sc: 67.8 .>>.>>>...>>>>............<<<<.>>>>>.........<.<<<<..................>>>>.......<<<<...........<<<<<.... GCG.TTGGTGGTGT.AGTGGTg.A..GCACAGCTGCCTTT.CAA.G.CAGTTA.............ACGCGGGTTCGATTCCCGG.........GTAACGAA.. tRNA-Glu-TTC-5-1 Sc: 54.6 (filtered) best isotype model: Gly Sc: 63.7 >>>.>>>>..>..>............<..<.>>>>>.........<.<<<<.................>>>...........<<<.........<<<<<<<... GCA.TTGGTGGTGT.AGTGGT..A..GACTTCTCGCCCGC.AAC.G.CGGGAG.............GCCCGCGTCCGATTACCGG.........CCAATGCA.. tRX-Cys-NNN-3-1 Sc: 26.1 (filtered) best isotype model: Gly Sc: 61.4 >>>...>>..>>>>............<<<<.>>.>............<.<<..................>>>>.......<<<<..........<<..<<<... GCA.ATGGTGGTTC.AGTGGT..A..GAATTCTCGCCTTT.CAC.A.CAGGAG.............ACCCGGGTTCAATTCCTGA.........CCCATGTAca tRNA-Glu-TTC-9-1 Sc: 36.1 (filtered) best isotype model: Gly Sc: 59.0 >>>.>>.>..>>>>............<<<<.>>>>............<<<<.................>>>>>.......<<<<<.........<.<<<<<... GCG.TTGGCAGTTC.AGTGGT..A..GAATTCTCGCCTCC.CAC.C.CGGGAG.............ACCTGGATTCCATTTCCGG.........CAAATGCA.. tRX-Gly-NNN-1-1 Sc: 27.6 (filtered) best isotype model: Gly Sc: 57.1 GCG.TTGGCAGTTC.AGTGGT..A..GAATTCTCGCCTCC.CAC.C.CGGGAG.............ACCTGGATTCCATTTCCGG.........CAAATGCA.. tRX-Gly-NNN-1-2 Sc: 27.6 (filtered) best isotype model: Gly Sc: 57.1 >>>.>>>>..>>>>............<<<<.>.>>>.........<.<<.<.................>>>.>.......<.<<<.........<<<<<<<... GCG.TCAGTGGTTT.AGTGGT..G..GAATTCCTGCCTCC.CAT.G.CACGAG.............ATCCGTGTTCAACTCCTGG.........TTGGTGCA.. tRNA-Gly-CCC-8-1 Sc: 35.0 (filtered) best isotype model: Gly Sc: 56.7 >>>.>>>...>>.>............<.<<.>.>>>.........<.<<.<.................>.>...........<.<..........<<<<<<... GTG.TTGATGGTAT.AGTGGTg.A..GCATAGCTGCCTTC.CAA.G.CAATTG.............ACCCGACTTCAATTCCCAG.........CCAACGCA.. tRNA-Gly-TCC-6-1 Sc: 28.8 (filtered) best isotype model: Gly Sc: 56.2 GTG.TTGATGGTAT.AGTGGTg.A..GCATAGCTGCCTTC.CAA.G.CAATTG.............ACCCGACTTCGATTCCCAG.........CCAATGCA.. tRNA-Gly-TCC-5-1 Sc: 28.8 (filtered) best isotype model: Gly Sc: 55.8 >>..>>>>..>>.>............<.<<.>>>.>.........<..<<<.................>>>>>.......<<<<<.........<<<<.<<... GCA.TTGGTAGTTC.AGCGGT..G..GCATTCTCCCCACC.TAC.G.CGGGAG.............ACCTGGGTTCAACTCCCGG.........CCAAAGCA.. tRNA-Arg-CCT-6-1 Sc: 23.8 (filtered) best isotype model: Gly Sc: 50.7 GCA.TTGGTAGTTC.AGCGGT..G..GCATTCTCCCCACC.TAC.G.CGGGAG.............ACCTGGGTTCAACTCCCGG.........CCAAAGCA.. tRNA-Arg-CCT-6-2 Sc: 23.8 (filtered) best isotype model: Gly Sc: 50.7 >>>.>>>>..>>>>............<<<<.>.>>>.........<.<<.<.................>>>.>.......<.<<<.........<<<<<<<... GCG.TCAGTGGTTTtAGTGGT..G..GAATTCCTGCCTCC.CAT.G.CACGAG.............ATCCGTGTTCAACTCCTGG.........TTGGTGCA.. tRX-Gly-NNN-2-1 Sc: 28.2 (filtered) best isotype model: Gly Sc: 49.5 >.>.>>>>..>>.>............<.<<.>>.>............<.<<.................>>.>>.......<<.<<.........<<<<<.<... GGA.TTGGTGGTCC.AGTGGT..A..GAATTCTCACCGCC.TGC.A.TAGGAG.............ACCCTGGTTTAATTCCTGG.........CCAATGCA.. tRNA-Arg-CCT-7-1 Sc: 22.4 (filtered) best isotype model: Gly Sc: 49.2 >>>.>>>>..>>>..............<<<.>>>>>.........<.<<<<.................>>>>>.......<<<<<.........<<<<<<<... GGT.CTTGT.GCTC.AGTGG......AAGCCTCTGTCTGAcCAT.A.CAGATG.............ATCCAGGTTCGAATCCTGG.........CAAGGCCA.. tRNA-Und-NNN-2-1 Sc: 26.7 (filtered) best isotype model: Gly Sc: 27.7 >>>.>.>>...>................<..>>>>>.........<.<<<<.................>>>>>.......<<<<<.........<<.<<<<... GGT.ACAGTGTTAA.AGGGGAgaA..AAATTGCTGACTTT.GAA.TaCAGTAG.............ACCTAGGTTTGAATCCTGG.........CTTTACCA.. tRX-Gln-NNN-1-1 Sc: 21.5 (filtered) best isotype model: Gly Sc: 18.0 >>>.>>>>..>>................<<..>>>>.........<.<<<..................>>>>>.......<<<<<.........<<<<<<<... GTGcAGAGTAGTAC.AGTGGTt.A..A.ACCATGGTCTTT.GGA.G.CCAGA.CT...........GCCTGGGGTCGGATCCCAG.........CTCTCACA.. tRNA-Gln-TTG-10-1 Sc: 20.6 (filtered) best isotype model: Gly Sc: 7.1 >>>.>>....>>.>............<.<<.>.>>>.........<.<<.<.................>>>>>.......<<<<<...........<<<<<... GCC.AGCATGGTAT.AGTGGTtaA..ACAC.CAGGATTCT.GAAgT.TCAGCT.............GCCTGGGTTCAAATCCCAG.acctca...CTTGGCA.. tRX-Gln-NNN-2-1 Sc: 23.2 (filtered) best isotype model: Gly Sc: 4.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
23.821.4-4.435.635.032.323.386.448.520.3-1.6-4.58.7No Hit17.5-14.05.626.119.921.936.6No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (5)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
6 (5′ Acceptor Stem)chr1:161410027rs113917836G / TYesYesbase pair mismatch
45 (Variable Loop)chr1:161409988rs571944925G / TNoYessubstitution in loop
50 (5′ T-arm)chr1:161409984rs116460444C / TNoYesGU base pair
54 (T-Psi-C Loop)chr1:161409980rs112984534C / TYesYesuniversal base restore
61 (3′ T-arm)chr1:161409973rs566166424C / ANoYesbase pair mismatch
Expression Profiles