Gene: tRNA-Leu-CAG-2-1

Overview
Organism Homo sapiens
Locus chr16:57333863-57333945 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Leu-CAG-2-1
HGNC Symbol TRL-CAG2-1
RNAcentral ID URS00000FB60D_9606
tRNAscan-SE ID chr16.trna18
GtRNAdb 2009
Legacy Name and Score
chr16.trna17-LeuCAG (75.90 bits)
Predicted tRNA Isotype / Anticodon Leu CAG
Top Scoring / Second Best Scoring Isotype Model Leu (124.5 bits) / Ser (76.2 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 2
Upstream / Downstream Sequence AAAATAGTCTCTCCTAGGAA / AGCGCTCTTTTCCGGTATTT
Intron None
Possible Pseudogene No
Gene Score 77.3
Mature tRNA Score 77.3
HMM Score 47.50
Secondary Structure Score 29.80
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GTCAGGATGGCCGAGCGGTctAAGGCGCTGCGTTCAGGTCGCAGTCTCCCCTGGAGGCGTGGGTTCGAATCCCACTTCTGACA
Secondary Structure (nested bp)
>>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GUCAGGAUGGCCGAGCGGUCUAAGGCGCUGCGUUCAGGUCGCAGUCUCCCCUGGAGGCGUGGGUUCGAAUCCCACUUCUGACA
Alignments
Leu tRNAs
>>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-1-1 Sc: 75.2 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-1-2 Sc: 75.2 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-1-3 Sc: 75.2 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-1 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-2 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-3 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-4 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCAAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-3-1 Sc: 73.8 >>>>>>>..>.>..............<.<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGT.GGTct.A.AGACGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTTGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-4-1 Sc: 64.4 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... DL9991_AAG_HUMAN_CY >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-1 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-2 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-3 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-4 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-5 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-6 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-7 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAG-2-1 Sc: 77.3 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAG-2-2 Sc: 77.3 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-TAG-1-1 Sc: 75.2 GGTAGTGTGGCCGAGC.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CACTGCCA... tRNA-Leu-TAG-2-1 Sc: 74.1 GGTAGCGTGGCCGAGT.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CATT..TC........GATGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-TAG-3-1 Sc: 73.9 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... DL9990_TAG_HUMAN_CY >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGcttactgcttcctgtgttcgggtcTTCTGGT..CTCC..GTAT......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-2-1 Sc: 78.0 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGttgctacttcccaggtttggggc.TTCTGGT..CTCC..GCAT......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-3-1 Sc: 77.3 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGctaagcttcctccgcggtgggga.TTCTGGT..CTCC..AAT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-1-1 Sc: 77.2 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGcttggcttcctcgtgttgagga..TTCTGGT..CTCC..AAT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-1-2 Sc: 77.2 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>>..........<<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGgtaagcaccttgcctgcgggct..TTCTGGT..CTCCGG........ATGGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-4-1 Sc: 73.6 >>>>>>>..>>>>............<<<<.>>>>.................................<<<<..........................>>>>>.......<<<<<.<<<<<<<.... GCCTCCTTAGTGCAGTAGGT...A.GCGCATCAGTCTCAAA........................ATCTGAAtG....................GtCCTGAGTTCAAGCCTCAG.AGGGGGCA... tRNA-Leu-CAA-5-1 Sc: 66.5 >>>>>>>..>>>..............<<<..>>>>...............................<<<<....>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGC.AGTcttA.AGGCGCTGCGTTCAAA........................TCGCACC..CTCC..GCT.......GGAGG.CGTGGGTTCGAATCCCAC.TTTTGACA... tRNA-Leu-CAA-6-1 Sc: 57.5 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... ACCGGGATGGCCGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGGCTG........GTGCCCG.CGTGGGTTCGAACCCCAC.TCTCGGTA... tRNA-Leu-TAA-2-1 Sc: 90.8 ACCAGGATGGCCGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGAC..ATAT......GTCCG.CGTGGGTTCGAACCCCAC.TCCTGGTA... tRNA-Leu-TAA-1-1 Sc: 88.7 ACCAGAATGGCCGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGAT..TCAT......ATCCG.CGTGGGTTCGAACCCCAC.TTCTGGTA... tRNA-Leu-TAA-3-1 Sc: 85.0 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>>..........<<<<<...>>>>>.......<<<<<.<<<<<<<.... ACCGGGATGGCTGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGACAG........GTGTCCG.CGTGGGTTCGAGCCCCAC.TCCCGGTA... tRNA-Leu-TAA-4-1 Sc: 83.8 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTNAAG........................TTCTGGT.CTCCGG..........ATGGAG.CGTGGGTTCGAATCCCAC.TTCTGACAcca RL9990_NAA_HUMAN_HELA-CELLS >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... RL9990_NAA_HUMAN_HELA-CELLS
.>>>>>>....>>............<<..>>>>>.......<<<<<...>>.>..........<.<<..>>>>>........<<<<..<...<<<<<<.. GTCAGGG.TGGCTGAGCAGTctG.AGGGGCTGCGTTCAGGTCGCAGT..CTGCCCT.......GGAGGCGTGGG.TTCGAATCCCA..C...TCCTGAAA tRX-Leu-NNN-1-1 Sc: 31.6 (filtered) best isotype model: Leu Sc: 73.1 >>>>>.>...>>>............<<<.>>>.>.......<.<<<...>>>>..........<<<<...>>>>........<<<<......<.<<<<<. GGTAGGG.TGGCCGAGCGGTctA.AGGCACTGTATTAAGACTCCAGT..CTCTTC........AGAGGCATGGG.TTTGAATCCCA..C...TGCTGCCA tRNA-Leu-AAG-6-1 Sc: 45.4 (filtered) best isotype model: Leu Sc: 72.8 >>>>>>>...>>>............<<<..>>>.........<<<....>>>>..........<<<<..>>>>>........<<<<..<...<<<<<<<. ACCAGGA.TGGCCAAGTAGTtaA.AGGCACTGGACTTAAGAGCCAAT..GGACATAT......GTCTGTGTGGG.TTTGAACCCCA..C...TCCTGGTG tRX-Leu-NNN-2-1 Sc: 45.5 (filtered) best isotype model: Leu Sc: 65.9 .>>>>>>...>>>............<<<.>>>.>.......<.<<<...>>>............<<<..>>>>>........<<<<..<...<<<<<<.. GGTAGTG.TGGTTGAATGGTctA.AGGCACTGAATTTAGGCTCCAGT..CTC.TTTG.......GGGACGTGGG.TTTAAATCCCA..C...TGCTGCAA tRNA-Leu-TAG-4-1 Sc: 38.7 (filtered) best isotype model: Leu Sc: 61.8 >>>..>....>>>............<<<.>>>>>.......<<<<<...>..>..........<..<..>>>>>........<<<<..<....<..<<<. ACTCATT.TGGCTGAGTGGTt.A.AGGCATTGGACTTAAGATCCAATG.GAGTAGT.......GGCTGTGTGGG.TTTAAACCCCA..C...TACTGGTA tRNA-Leu-TAA-5-1 Sc: 37.1 (filtered) best isotype model: Leu Sc: 49.9 >>>>>>....>.>............<.<.>>>.>.......<.<<<...>>>............<<<..>>>>..........<<<..<....<<<<<<. GGTAGCA.TGGCTGAGTGGTctA.AGATTCTGAATTAAGTCTCCAGT..CTC.TTTG.......GGGGCGTGGTtTTCAATC.CCA..C...CGCTGCTA tRNA-Leu-AAG-8-1 Sc: 27.5 (filtered) best isotype model: Leu Sc: 38.0 >.>.>>>...>>>............<<<.>>>>.........<<<<...>>>>..........<<<<..>>>>>........<<<<..<...<<<.<.<. GATAGCAa.GGCCGAGCGGTctA.AGGCTCCGGATTAAGGCGCCGGTGtCTTC..........GGAGGCATGGG.TTCGAATTCCAccT.c.TGCCAACT tRNA-Leu-AAG-7-1 Sc: 24.1 (filtered) best isotype model: Leu Sc: 36.3
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
30.237.20.15.430.532.8-6.127.965.847.0124.5-1.86.7No Hit25.6No Hit76.244.620.731.031.4No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (40)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
3 (5′ Acceptor Stem)chr16:57333865rs576137771C / GNoYesbase pair mismatch
3 (5′ Acceptor Stem)chr16:57333865rs576137771C / TNoYesGU base pair
5 (5′ Acceptor Stem)chr16:57333867rs186671489G / CNoYesbase pair mismatch
7 (5′ Acceptor Stem)chr16:57333869rs767271252A / GNoNoGU base pair
12 (5′ D-arm)chr16:57333874rs192561748C / TNoYesGU base pair
22 (3′ D-arm)chr16:57333885rs750355007A / GNoNobase pair mismatch
23 (3′ D-arm)chr16:57333886rs553820134G / ANoNobase pair mismatch
25 (3′ D-arm)chr16:57333888rs565123577C / TNoYesGU base pair
27 (5′ Anticodon Stem)chr16:57333890rs184840621C / GNoYesbase pair mismatch
31 (5′ Anticodon Stem)chr16:57333894rs540977100G / ANoYesbase pair mismatch
34 (Anticodon Loop)chr16:57333897rs572366725C / TNoNosynonymous anticodon change
37 (Anticodon Loop)chr16:57333900rs756048795G / ANoNosubstitution in loop
38 (Anticodon Loop)chr16:57333901rs374147028T / CNoNosubstitution in loop
39 (3′ Anticodon Stem)chr16:57333902rs149619861C / GNoYesbase pair mismatch
39 (3′ Anticodon Stem)chr16:57333902rs149619861C / TNoYesGU base pair
40 (3′ Anticodon Stem)chr16:57333903rs758926094G / ANoNobase pair mismatch
44 (Variable Loop)chr16:57333907rs527689079T / CNoYessubstitution in loop
e12 (Variable Stem)chr16:57333909rs549019934T / GNoYesbase pair mismatch
e13 (Variable Stem)chr16:57333910rs540667446C / ANoYesbase pair mismatch
e13 (Variable Stem)chr16:57333910rs540667446C / TNoYesGU base pair
e14 (Variable Stem)chr16:57333911rs144318503C / ANoYesbase pair mismatch
e14 (Variable Stem)chr16:57333911rs144318503C / TNoYesGU base pair
e1 (Variable Stem)chr16:57333912rs563336517C / GNoYessubstitution in loop
e1 (Variable Stem)chr16:57333912rs563336517C / TNoYessubstitution in loop
e2 (Variable Stem)chr16:57333913rs188151073C / TNoYessubstitution in loop
e3 (Variable Stem)chr16:57333914rs571837733T / GNoYessubstitution in loop
e23 (Variable Stem)chr16:57333916rs758778541G / TNoNobase pair mismatch
e21 (Variable Stem)chr16:57333918rs538961131G / ANoYesbase pair mismatch
48 (Variable Loop)chr16:57333920rs778037829C / TNoNosubstitution in loop
49 (5′ T-arm)chr16:57333921rs577579670G / ANoYesbase pair mismatch
49 (5′ T-arm)chr16:57333921rs577579670G / TNoYesbase pair mismatch
55 (T-Psi-C Loop)chr16:57333927rs565636543T / GNoYesuniversal base change
56 (T-Psi-C Loop)chr16:57333928rs148345977C / TNoYesuniversal base change
58 (T-Psi-C Loop)chr16:57333930rs192959558A / GNoYesuniversal base change
59 (T-Psi-C Loop)chr16:57333931rs184470556A / GNoYessubstitution in loop
62 (3′ T-arm)chr16:57333934rs189619484C / TNoYesGU base pair
63 (3′ T-arm)chr16:57333935rs748800170C / GNoNobase pair mismatch
64 (3′ T-arm)chr16:57333936rs142778319A / GNoYesGU base pair
65 (3′ T-arm)chr16:57333937rs577010596C / ANoYesbase pair mismatch
70 (3′ Acceptor Stem)chr16:57333942rs181911634G / ANoYesbase pair mismatch
Expression Profiles