Gene: tRNA-Leu-CAG-2-2

Overview
Organism Homo sapiens
Locus chr16:57334392-57334474 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Leu-CAG-2-2
HGNC Symbol TRL-CAG2-2
RNAcentral ID URS00000FB60D_9606
tRNAscan-SE ID chr16.trna27
GtRNAdb 2009
Legacy Name and Score
chr16.trna26-LeuCAG (75.90 bits)
Predicted tRNA Isotype / Anticodon Leu CAG
Top Scoring / Second Best Scoring Isotype Model Leu (124.5 bits) / Ser (76.2 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 2
Upstream / Downstream Sequence TGCGCCACACACTGCAAGCA / GAGCTCAATTACTTTTCCTC
Intron None
Possible Pseudogene No
Gene Score 77.3
Mature tRNA Score 77.3
HMM Score 47.50
Secondary Structure Score 29.80
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GTCAGGATGGCCGAGCGGTctAAGGCGCTGCGTTCAGGTCGCAGTCTCCCCTGGAGGCGTGGGTTCGAATCCCACTTCTGACA
Secondary Structure (nested bp)
>>>>>>>..>>>...........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GUCAGGAUGGCCGAGCGGUCUAAGGCGCUGCGUUCAGGUCGCAGUCUCCCCUGGAGGCGUGGGUUCGAAUCCCACUUCUGACA
Alignments
Leu tRNAs
>>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-1-1 Sc: 75.2 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-1-2 Sc: 75.2 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-1-3 Sc: 75.2 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-1 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-2 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-3 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-2-4 Sc: 74.8 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCAAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-3-1 Sc: 73.8 >>>>>>>..>.>..............<.<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGT.GGTct.A.AGACGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTTGAATCCCAC.CGCTGCCA... tRNA-Leu-AAG-4-1 Sc: 64.4 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTAAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... DL9991_AAG_HUMAN_CY >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-1 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-2 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-3 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-4 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-5 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-6 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TCCTGACA... tRNA-Leu-CAG-1-7 Sc: 78.2 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAG-2-1 Sc: 77.3 GTCAGGATGGCCGAGC.GGTct.A.AGGCGCTGCGTTCAGG........................TCGCAGT..CTCC..CCT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAG-2-2 Sc: 77.3 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-TAG-1-1 Sc: 75.2 GGTAGTGTGGCCGAGC.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CTCT..TC........GGGGG.CGTGGGTTCGAATCCCAC.CACTGCCA... tRNA-Leu-TAG-2-1 Sc: 74.1 GGTAGCGTGGCCGAGT.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CATT..TC........GATGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... tRNA-Leu-TAG-3-1 Sc: 73.9 GGTAGCGTGGCCGAGC.GGTct.A.AGGCGCTGGATTTAGG........................CTCCAGT..CTCT..TC........GGAGG.CGTGGGTTCGAATCCCAC.CGCTGCCA... DL9990_TAG_HUMAN_CY >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGcttactgcttcctgtgttcgggtcTTCTGGT..CTCC..GTAT......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-2-1 Sc: 78.0 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGttgctacttcccaggtttggggc.TTCTGGT..CTCC..GCAT......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-3-1 Sc: 77.3 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGctaagcttcctccgcggtgggga.TTCTGGT..CTCC..AAT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-1-1 Sc: 77.2 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGcttggcttcctcgtgttgagga..TTCTGGT..CTCC..AAT.......GGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-1-2 Sc: 77.2 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>>..........<<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTCAAGgtaagcaccttgcctgcgggct..TTCTGGT..CTCCGG........ATGGAGG.CGTGGGTTCGAATCCCAC.TTCTGACA... tRNA-Leu-CAA-4-1 Sc: 73.6 >>>>>>>..>>>>............<<<<.>>>>.................................<<<<..........................>>>>>.......<<<<<.<<<<<<<.... GCCTCCTTAGTGCAGTAGGT...A.GCGCATCAGTCTCAAA........................ATCTGAAtG....................GtCCTGAGTTCAAGCCTCAG.AGGGGGCA... tRNA-Leu-CAA-5-1 Sc: 66.5 >>>>>>>..>>>..............<<<..>>>>...............................<<<<....>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... GTCAGGATGGCCGAGC.AGTcttA.AGGCGCTGCGTTCAAA........................TCGCACC..CTCC..GCT.......GGAGG.CGTGGGTTCGAATCCCAC.TTTTGACA... tRNA-Leu-CAA-6-1 Sc: 57.5 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... ACCGGGATGGCCGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGGCTG........GTGCCCG.CGTGGGTTCGAACCCCAC.TCTCGGTA... tRNA-Leu-TAA-2-1 Sc: 90.8 ACCAGGATGGCCGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGAC..ATAT......GTCCG.CGTGGGTTCGAACCCCAC.TCCTGGTA... tRNA-Leu-TAA-1-1 Sc: 88.7 ACCAGAATGGCCGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGAT..TCAT......ATCCG.CGTGGGTTCGAACCCCAC.TTCTGGTA... tRNA-Leu-TAA-3-1 Sc: 85.0 >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>>..........<<<<<...>>>>>.......<<<<<.<<<<<<<.... ACCGGGATGGCTGAGT.GGTt..A.AGGCGTTGGACTTAAG........................ATCCAAT..GGACAG........GTGTCCG.CGTGGGTTCGAGCCCCAC.TCCCGGTA... tRNA-Leu-TAA-4-1 Sc: 83.8 GTCAGGATGGCCGAGT.GGTct.A.AGGCGCCAGACTNAAG........................TTCTGGT.CTCCGG..........ATGGAG.CGTGGGTTCGAATCCCAC.TTCTGACAcca RL9990_NAA_HUMAN_HELA-CELLS >>>>>>>..>>>..............<<<.>>>>>...............................<<<<<...>>>>............<<<<...>>>>>.......<<<<<.<<<<<<<.... RL9990_NAA_HUMAN_HELA-CELLS
.>>>>>>....>>............<<..>>>>>.......<<<<<...>>.>..........<.<<..>>>>>........<<<<..<...<<<<<<.. GTCAGGG.TGGCTGAGCAGTctG.AGGGGCTGCGTTCAGGTCGCAGT..CTGCCCT.......GGAGGCGTGGG.TTCGAATCCCA..C...TCCTGAAA tRX-Leu-NNN-1-1 Sc: 31.6 (filtered) best isotype model: Leu Sc: 73.1 >>>>>.>...>>>............<<<.>>>.>.......<.<<<...>>>>..........<<<<...>>>>........<<<<......<.<<<<<. GGTAGGG.TGGCCGAGCGGTctA.AGGCACTGTATTAAGACTCCAGT..CTCTTC........AGAGGCATGGG.TTTGAATCCCA..C...TGCTGCCA tRNA-Leu-AAG-6-1 Sc: 45.4 (filtered) best isotype model: Leu Sc: 72.8 >>>>>>>...>>>............<<<..>>>.........<<<....>>>>..........<<<<..>>>>>........<<<<..<...<<<<<<<. ACCAGGA.TGGCCAAGTAGTtaA.AGGCACTGGACTTAAGAGCCAAT..GGACATAT......GTCTGTGTGGG.TTTGAACCCCA..C...TCCTGGTG tRX-Leu-NNN-2-1 Sc: 45.5 (filtered) best isotype model: Leu Sc: 65.9 .>>>>>>...>>>............<<<.>>>.>.......<.<<<...>>>............<<<..>>>>>........<<<<..<...<<<<<<.. GGTAGTG.TGGTTGAATGGTctA.AGGCACTGAATTTAGGCTCCAGT..CTC.TTTG.......GGGACGTGGG.TTTAAATCCCA..C...TGCTGCAA tRNA-Leu-TAG-4-1 Sc: 38.7 (filtered) best isotype model: Leu Sc: 61.8 >>>..>....>>>............<<<.>>>>>.......<<<<<...>..>..........<..<..>>>>>........<<<<..<....<..<<<. ACTCATT.TGGCTGAGTGGTt.A.AGGCATTGGACTTAAGATCCAATG.GAGTAGT.......GGCTGTGTGGG.TTTAAACCCCA..C...TACTGGTA tRNA-Leu-TAA-5-1 Sc: 37.1 (filtered) best isotype model: Leu Sc: 49.9 >>>>>>....>.>............<.<.>>>.>.......<.<<<...>>>............<<<..>>>>..........<<<..<....<<<<<<. GGTAGCA.TGGCTGAGTGGTctA.AGATTCTGAATTAAGTCTCCAGT..CTC.TTTG.......GGGGCGTGGTtTTCAATC.CCA..C...CGCTGCTA tRNA-Leu-AAG-8-1 Sc: 27.5 (filtered) best isotype model: Leu Sc: 38.0 >.>.>>>...>>>............<<<.>>>>.........<<<<...>>>>..........<<<<..>>>>>........<<<<..<...<<<.<.<. GATAGCAa.GGCCGAGCGGTctA.AGGCTCCGGATTAAGGCGCCGGTGtCTTC..........GGAGGCATGGG.TTCGAATTCCAccT.c.TGCCAACT tRNA-Leu-AAG-7-1 Sc: 24.1 (filtered) best isotype model: Leu Sc: 36.3
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
30.237.20.15.430.532.8-6.127.965.847.0124.5-1.86.7No Hit25.6No Hit76.244.620.731.031.4No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (44)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr16:57334474rs553335510G / CNoNobase pair mismatch
2 (5′ Acceptor Stem)chr16:57334473rs572007558ATGCGCCACACACTGCAAGCAGT / -NoYesbulge in stem
4 (5′ Acceptor Stem)chr16:57334471rs563765931A / GNoYesGU base pair
5 (5′ Acceptor Stem)chr16:57334470rs553420403G / ANoYesbase pair mismatch
6 (5′ Acceptor Stem)chr16:57334469rs575060679G / TNoYesbase pair mismatch
7 (5′ Acceptor Stem)chr16:57334468rs148170362A / CNoYesbase pair mismatch
8 (Acceptor-D-arm-linker)chr16:57334467rs756990286T / CNoNouniversal base change
8 (Acceptor-D-arm-linker)chr16:57334467rs756990286T / ANoNouniversal base change
10 (5′ D-arm)chr16:57334465rs143640104G / ANoYesbase pair mismatch
11 (5′ D-arm)chr16:57334464rs746613507C / TNoNoGU base pair
12 (5′ D-arm)chr16:57334463rs535331738C / TNoNoGU base pair
13 (5′ D-arm)chr16:57334462rs535079486G / CNoYesbase pair mismatch
15 (D-loop)chr16:57334460rs757836691G / ANoNosubstitution in loop
21 (D-loop)chr16:57334453rs140512686A / GNoYesuniversal base change
23 (3′ D-arm)chr16:57334451rs541733066G / TNoNobase pair mismatch
23 (3′ D-arm)chr16:57334451rs541733066G / ANoNobase pair mismatch
24 (3′ D-arm)chr16:57334450rs756556550G / TNoNobase pair mismatch
26 (D-arm-Anticodon-linker)chr16:57334448rs571201725G / ANoYessubstitution in loop
31 (5′ Anticodon Stem)chr16:57334443rs552788877G / ANoNobase pair mismatch
33 (Anticodon Loop)chr16:57334441rs558908938T / GNoYesuniversal base change
37 (Anticodon Loop)chr16:57334437rs762060201G / ANoNosubstitution in loop
39 (3′ Anticodon Stem)chr16:57334435rs774412609C / TNoNoGU base pair
40 (3′ Anticodon Stem)chr16:57334434rs764291606G / TNoNobase pair mismatch
43 (3′ Anticodon Stem)chr16:57334431rs146804421G / ANoYesbase pair mismatch
44 (Variable Loop)chr16:57334430rs191990559T / CNoYessubstitution in loop
e13 (Variable Stem)chr16:57334427rs772005894C / ANoNobase pair mismatch
e2 (Variable Stem)chr16:57334424rs570282620C / TNoYessubstitution in loop
e24 (Variable Stem)chr16:57334422rs535641452G / ANoYesbase pair mismatch
e21 (Variable Stem)chr16:57334419rs769863555G / ANoNobase pair mismatch
48 (Variable Loop)chr16:57334417rs745748289C / TNoNosubstitution in loop
49 (5′ T-arm)chr16:57334416rs567870402G / CNoYesbase pair mismatch
56 (T-Psi-C Loop)chr16:57334409rs776596874C / TNoNouniversal base change
57 (T-Psi-C Loop)chr16:57334408rs865836471G / ANoNosubstitution in loop
57 (T-Psi-C Loop)chr16:57334408rs760638139- / TNoNosubstitution in loop
61 (3′ T-arm)chr16:57334404rs187522089C / TNoYesGU base pair
62 (3′ T-arm)chr16:57334403rs528168172C / TNoYesGU base pair
64 (3′ T-arm)chr16:57334401rs528990877A / GNoNoGU base pair
64 (3′ T-arm)chr16:57334401rs528990877A / CNoNobase pair mismatch
66 (3′ Acceptor Stem)chr16:57334399rs561476999T / GNoYesbase pair mismatch
66 (3′ Acceptor Stem)chr16:57334399rs561476999T / CNoYesbase pair mismatch
67 (3′ Acceptor Stem)chr16:57334398rs552137411T / GNoYesbase pair mismatch
68 (3′ Acceptor Stem)chr16:57334397rs143738710C / TNoYesGU base pair
72 (3′ Acceptor Stem)chr16:57334393rs540265129C / GNoNobase pair mismatch
73 (3′ end)chr16:57334392rs184714345A / CNoYessubstitution in loop
Expression Profiles