Gene: tRNA-Phe-GAA-1-6

Overview
Organism Homo sapiens
Locus chr19:1383361-1383433 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Phe-GAA-1-6
HGNC Symbol TRF-GAA1-6
RNAcentral ID URS000029CCC5_9606
tRNAscan-SE ID chr19.trna12
GtRNAdb 2009
Legacy Name and Score
chr19.trna14-PheGAA (84.19 bits)
Predicted tRNA Isotype / Anticodon Phe GAA
Top Scoring / Second Best Scoring Isotype Model Phe (124.5 bits) / Tyr (83.7 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 12
Upstream / Downstream Sequence GAGAGCGACTCTGCCGCCCA / GAAGTTTTAGCGCCTCTTGC
Intron None
Possible Pseudogene No
Gene Score 88.9
Mature tRNA Score 88.9
HMM Score 68.40
Secondary Structure Score 20.50
Atypical Features None
Known Modifications (Modomics) m2G10 m1A14 D16 D17 m2,2G26 Ψ27 Ψ28 Cm32 Gm34 o2yW37 Ψ39 m7G46 D47 m5C49 m5U54 Ψ55 m1A58
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAAGGtCCCTGGTTCGATCCCGGGTTTCGGCA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCA
Alignments
Phe tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-1 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-2 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-3 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-4 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-5 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-6 Sc: 88.9 GCCGAGATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-3-1 Sc: 88.3 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-2-1 Sc: 87.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACCGAAGATCTtAAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-4-1 Sc: 75.5 >>>>>>>..>>>>........<<<<.>.>>>.......<<<..<.................>>>>>.......<<<<<<<<<<<<.... GCTGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.TAAA...........GttCCCTGGTTCAACCCTGGGTTTCAGCC... tRNA-Phe-GAA-6-1 Sc: 58.8 >>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCAcca RF9990_GAA_HUMAN_PLACENTA
>>>.>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<.....<<<.... GCCAAAATTGCTCAGTTGGGAGAGCGTTAGACTGAAG...ATCTAAAG...........GtCCCTGGTTCGATCCCGGGTTTCaccaGGTT... tRNA-Phe-GAA-5-1 Sc: 65.8 (filtered) best isotype model: Phe Sc: 102.9 .>..>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<......<..... GCCAAAATAGCTCAGCTGGGAGAGCATTAGACTGAAG...ATCTAAAG...........GtCTCTGGTTTGATCCTGGGTTTC....AGAA... tRNA-Phe-GAA-8-1 Sc: 45.5 (filtered) best isotype model: Phe Sc: 86.7 >.>>>>>..>>>>........<<<<..>>>>..........<<<<.................>>>>>.......<<<<<<<<<....<.<.... GCCGAAATAGCTCAATTGGGAGAGTGTTAGACTGAAGatcTTCTGCAG...........GtCTCTGGTTCAATTCCGGGTTTC....GACA... tRNA-Phe-GAA-7-1 Sc: 50.0 (filtered) best isotype model: Phe Sc: 78.5 >>>>>>>..>>>>........<<<<.>.>>............<<.<.................>>>>.......<<<<.<<<<....<<<.... GCTGAGATAGCTCGGTTGGGAGGGCATCAGCCTGAAG...ATCTAAAG...........GaGACTGGTTCAATTCTGGGTTTT....GGCA... tRNA-Phe-GAA-11-1 Sc: 33.3 (filtered) best isotype model: Phe Sc: 41.1 .>>.>>>..>>>>........<<<<.>>..>..........<..<<................>>>.>.......<.<<<<<<.....<<..... GCCAAAATAGCTCAGCTGGGAGAGTATTAGGTTGAAG...ATACAAAG...........TtCCTTGGCTCAATCCAGAGTTTG....GGGGact tRNA-Phe-GAA-12-1 Sc: 22.4 (filtered) best isotype model: Phe Sc: 29.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
60.661.548.837.481.329.222.436.455.265.511.975.576.2124.539.5No Hit8.979.765.183.752.99.6
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-24.7No HitNo HitNo Hit38.5No HitNo HitNo HitNo HitNo Hit-13.8No Hit

Top score2nd highest score3rd highest score
DNA Variants (9)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
24 (3′ D-arm)chr19:1383410rs750288390G / ANoNobase pair mismatch
28 (5′ Anticodon Stem)chr19:1383406rs765023158T / CNoNobase pair mismatch
46 (Variable Loop)chr19:1383388rs779917256G / ANoNosubstitution in loop
49 (5′ T-arm)chr19:1383385rs531273847C / TNoYesGU base pair
50 (5′ T-arm)chr19:1383384rs571857504C / GNoYesbase pair mismatch
51 (5′ T-arm)chr19:1383383rs763620878T / CNoNorestore Watson-Crick base pair
58 (T-Psi-C Loop)chr19:1383376rs553635552A / GNoYesuniversal base change
65 (3′ T-arm)chr19:1383369rs560807489G / ANoNobase pair mismatch
66 (3′ Acceptor Stem)chr19:1383368rs545754341T / CNoYesbase pair mismatch
Expression Profiles