Gene: tRNA-Pro-AGG-2-1

Overview
Organism Homo sapiens
Locus chr1:167684725-167684796 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-AGG-2-1
HGNC Symbol TRP-AGG2-1
RNAcentral ID URS00005DB87D_9606
tRNAscan-SE ID chr1.trna62
GtRNAdb 2009
Legacy Name and Score
chr1.trna65-ProAGG (75.92 bits)
Predicted tRNA Isotype / Anticodon Pro AGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 4
Upstream / Downstream Sequence AGTAAGGTGGAGTTTGTGTC / TGTTTTGGAGTAAGAATCAC
Intron None
Possible Pseudogene No
Gene Score 70.2
Mature tRNA Score 70.2
HMM Score 43.80
Secondary Structure Score 26.40
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.139.8-8.853.450.951.850.961.958.627.419.0-3.628.04.8121.0No Hit4.756.750.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (28)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
2 (5′ Acceptor Stem)chr1:167684795rs568980284G / ANoYesbase pair mismatch
3 (5′ Acceptor Stem)chr1:167684794rs530454308C / TNoNoGU base pair
12 (5′ D-arm)chr1:167684785rs759972297C / GNoNobase pair mismatch
13 (5′ D-arm)chr1:167684784rs550376408T / GNoYesGU base pair
14 (D-loop)chr1:167684783rs561460959A / -NoNodeletion in loop
25 (3′ D-arm)chr1:167684773rs529036236T / CNoYesrestore Watson-Crick base pair
26 (D-arm-Anticodon-linker)chr1:167684772rs561673821T / CNoYessubstitution in loop
29 (5′ Anticodon Stem)chr1:167684769rs144380637C / TNoYesGU base pair
30 (5′ Anticodon Stem)chr1:167684768rs544837795G / CNoNobase pair mismatch
31 (5′ Anticodon Stem)chr1:167684767rs775854374C / TNoNoGU base pair
33 (Anticodon Loop)chr1:167684765rs757229601- / TNoNoundetermined
35 (Anticodon Loop)chr1:167684763rs766681403G / ANoNonon synonymous anticodon change
37 (Anticodon Loop)chr1:167684761rs543797569G / CNoYessubstitution in loop
37 (Anticodon Loop)chr1:167684761rs543797569G / ANoYessubstitution in loop
43 (3′ Anticodon Stem)chr1:167684755rs144536979G / ANoYesbase pair mismatch
45 (Variable Loop)chr1:167684753rs186290162G / ANoYessubstitution in loop
48 (Variable Loop)chr1:167684750rs763410762C / TNoNosubstitution in loop
50 (5′ T-arm)chr1:167684748rs139769572C / TNoYesGU base pair
51 (5′ T-arm)chr1:167684747rs751568623G / CNoNobase pair mismatch
61 (3′ T-arm)chr1:167684737rs764151422C / ANoNobase pair mismatch
62 (3′ T-arm)chr1:167684736rs146352182C / TNoYesGU base pair
64 (3′ T-arm)chr1:167684734rs544848623G / ANoYesbase pair mismatch
65 (3′ T-arm)chr1:167684733rs565340379G / TNoYesbase pair mismatch
65 (3′ T-arm)chr1:167684733rs565340379G / CNoYesbase pair mismatch
66 (3′ Acceptor Stem)chr1:167684732rs776852639A / GNoNoGU base pair
67 (3′ Acceptor Stem)chr1:167684731rs201375220C / TNoNoGU base pair
67 (3′ Acceptor Stem)chr1:167684731rs201375220C / GNoNobase pair mismatch
68 (3′ Acceptor Stem)chr1:167684730rs182064313G / ANoYesbase pair mismatch
Expression Profiles