Gene: tRNA-Pro-AGG-2-5

Overview
Organism Homo sapiens
Locus chr14:21077495-21077566 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-AGG-2-5
HGNC Symbol TRP-AGG2-5
RNAcentral ID URS00005DB87D_9606
tRNAscan-SE ID chr14.trna23
GtRNAdb 2009
Legacy Name and Score
chr14.trna23-ProAGG (75.92 bits)
Predicted tRNA Isotype / Anticodon Pro AGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 4
Upstream / Downstream Sequence CCCAACCGAAATTCATAGGT / TGTTCCTTTTTTCTTTCTCT
Intron None
Possible Pseudogene No
Gene Score 70.2
Mature tRNA Score 70.2
HMM Score 43.80
Secondary Structure Score 26.40
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.139.8-8.853.450.951.850.961.958.627.419.0-3.628.04.8121.0No Hit4.756.750.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (29)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr14:21077566rs372279250G / ANoNobase pair mismatch
3 (5′ Acceptor Stem)chr14:21077564rs143472174C / TNoYesGU base pair
8 (Acceptor-D-arm-linker)chr14:21077559rs756008354T / CNoNouniversal base change
12 (5′ D-arm)chr14:21077555rs560857201C / TNoYesGU base pair
13 (5′ D-arm)chr14:21077554rs540642386T / GNoYesGU base pair
14 (D-loop)chr14:21077553rs528886346A / GNoYesuniversal base change
18 (D-loop)chr14:21077550rs190817074G / ANoYesuniversal base change
19 (D-loop)chr14:21077549rs45616241G / ANoYesuniversal base change
21 (D-loop)chr14:21077547rs575831428A / GNoYesuniversal base change
24 (3′ D-arm)chr14:21077544rs764712877A / GNoNoGU base pair
25 (3′ D-arm)chr14:21077543rs761466594T / CNoNorestore Watson-Crick base pair
26 (D-arm-Anticodon-linker)chr14:21077542rs776228734T / CNoNosubstitution in loop
27 (5′ Anticodon Stem)chr14:21077541rs757282759C / TNoNoGU base pair
29 (5′ Anticodon Stem)chr14:21077539rs187853013C / ANoYesbase pair mismatch
33 (Anticodon Loop)chr14:21077535rs557557209T / GNoYesuniversal base change
36 (Anticodon Loop)chr14:21077532rs531420318- / TNoNonon synonymous anticodon change
45 (Variable Loop)chr14:21077523rs182765490G / TNoYessubstitution in loop
45 (Variable Loop)chr14:21077523rs182765490G / CNoYessubstitution in loop
45 (Variable Loop)chr14:21077523rs182765490G / ANoYessubstitution in loop
52 (5′ T-arm)chr14:21077516rs572209550G / CNoYesbase pair mismatch
56 (T-Psi-C Loop)chr14:21077512rs763669947C / GNoNouniversal base change
61 (3′ T-arm)chr14:21077507rs554053830C / GNoYesbase pair mismatch
63 (3′ T-arm)chr14:21077505rs535434899C / TNoYesGU base pair
64 (3′ T-arm)chr14:21077504rs568451494G / CNoYesbase pair mismatch
66 (3′ Acceptor Stem)chr14:21077502rs757918245A / GNoNoGU base pair
67 (3′ Acceptor Stem)chr14:21077501rs146472361C / TNoYesGU base pair
67 (3′ Acceptor Stem)chr14:21077501rs146472361C / GNoYesbase pair mismatch
70 (3′ Acceptor Stem)chr14:21077498rs190539469G / TNoYesbase pair mismatch
70 (3′ Acceptor Stem)chr14:21077498rs190539469G / ANoYesbase pair mismatch
Expression Profiles