Gene: tRNA-Pro-AGG-2-6

Overview
Organism Homo sapiens
Locus chr14:21081560-21081631 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-AGG-2-6
HGNC Symbol TRP-AGG2-6
RNAcentral ID URS00005DB87D_9606
tRNAscan-SE ID chr14.trna22
GtRNAdb 2009
Legacy Name and Score
chr14.trna22-ProAGG (75.92 bits)
Predicted tRNA Isotype / Anticodon Pro AGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 4
Upstream / Downstream Sequence CTTAAGAGTATCTGTATCGC / TCGCTCTTTTCAACTCAACA
Intron None
Possible Pseudogene No
Gene Score 70.2
Mature tRNA Score 70.2
HMM Score 43.80
Secondary Structure Score 26.40
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.139.8-8.853.450.951.850.961.958.627.419.0-3.628.04.8121.0No Hit4.756.750.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (49)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
3 (5′ Acceptor Stem)chr14:21081629rs539333439C / TNoYesGU base pair
5 (5′ Acceptor Stem)chr14:21081627rs141857729C / TNoYesGU base pair
5 (5′ Acceptor Stem)chr14:21081627rs141857729C / GNoYesbase pair mismatch
8 (Acceptor-D-arm-linker)chr14:21081624rs557934418T / GNoNouniversal base change
8 (Acceptor-D-arm-linker)chr14:21081624rs557934418T / CNoNouniversal base change
11 (5′ D-arm)chr14:21081621rs191054904T / CNoYesbase pair mismatch
12 (5′ D-arm)chr14:21081620rs568372336C / TNoYesGU base pair
15 (D-loop)chr14:21081617rs372007499G / TNoYessubstitution in loop
15 (D-loop)chr14:21081617rs372007499G / CNoYessubstitution in loop
16 (D-loop)chr14:21081616rs148084282G / ANoYessubstitution in loop
23 (3′ D-arm)chr14:21081610rs11850665G / ANoYesbase pair mismatch
24 (3′ D-arm)chr14:21081609rs552836251A / GNoYesGU base pair
31 (5′ Anticodon Stem)chr14:21081602rs373363623C / GNoNobase pair mismatch
32 (Anticodon Loop)chr14:21081601rs527912322T / GNoYessubstitution in loop
34 (Anticodon Loop)chr14:21081599rs760972798- / ANoNosynonymous anticodon change
36 (Anticodon Loop)chr14:21081597rs144864996G / ANoYesnon synonymous anticodon change
36 (Anticodon Loop)chr14:21081597rs777240941- / TNoNonon synonymous anticodon change
37 (Anticodon Loop)chr14:21081596rs181640118G / ANoYessubstitution in loop
38 (Anticodon Loop)chr14:21081595rs771734665T / CNoNosubstitution in loop
39 (3′ Anticodon Stem)chr14:21081594rs575861987G / ANoYesbase pair mismatch
40 (3′ Anticodon Stem)chr14:21081593rs149420010C / TNoYesGU base pair
41 (3′ Anticodon Stem)chr14:21081592rs576120246- / TNoYesrepair bulge
41 (3′ Anticodon Stem)chr14:21081592rs576120246- / CNoYesrepair bulge
42 (3′ Anticodon Stem)chr14:21081591rs561576140A / CNoYesbase pair mismatch
45 (Variable Loop)chr14:21081588rs556024325G / ANoYessubstitution in loop
46 (Variable Loop)chr14:21081587rs780872840G / ANoNosubstitution in loop
48 (Variable Loop)chr14:21081585rs756896692C / TNoNosubstitution in loop
49 (5′ T-arm)chr14:21081584rs139260038C / TNoYesGU base pair
52 (5′ T-arm)chr14:21081581rs535725419G / CNoYesbase pair mismatch
53 (5′ T-arm)chr14:21081580rs146710592G / ANoYesbase pair mismatch
55 (T-Psi-C Loop)chr14:21081578rs539313659T / CNoNouniversal base change
57 (T-Psi-C Loop)chr14:21081576rs546585092- / TNoYessubstitution in loop
58 (T-Psi-C Loop)chr14:21081575rs534983574GTCCCGGGTTCAA / -NoYesdeletion in loop
59 (T-Psi-C Loop)chr14:21081574rs534724902A / GNoNosubstitution in loop
60 (T-Psi-C Loop)chr14:21081573rs571912571T / CNoYessubstitution in loop
62 (3′ T-arm)chr14:21081571rs753259440C / GNoNobase pair mismatch
63 (3′ T-arm)chr14:21081570rs765193455C / TNoNoGU base pair
64 (3′ T-arm)chr14:21081569rs553609592G / CNoYesbase pair mismatch
64 (3′ T-arm)chr14:21081569rs553609592G / ANoYesbase pair mismatch
65 (3′ T-arm)chr14:21081568rs142517005G / CNoYesbase pair mismatch
65 (3′ T-arm)chr14:21081568rs142517005G / ANoYesbase pair mismatch
66 (3′ Acceptor Stem)chr14:21081567rs570437647A / GNoYesGU base pair
67 (3′ Acceptor Stem)chr14:21081566rs866654287C / TNoNoGU base pair
67 (3′ Acceptor Stem)chr14:21081566rs774484569- / TNoNorepair bulge
68 (3′ Acceptor Stem)chr14:21081565rs376540772G / ANoYesbase pair mismatch
70 (3′ Acceptor Stem)chr14:21081563rs538319632G / TNoYesbase pair mismatch
70 (3′ Acceptor Stem)chr14:21081563rs538319632G / ANoYesbase pair mismatch
71 (3′ Acceptor Stem)chr14:21081562rs371837055C / TNoNoGU base pair
72 (3′ Acceptor Stem)chr14:21081561rs372956474C / TNoYesGU base pair
Expression Profiles