Gene: tRNA-Pro-CGG-1-2

Overview
Organism Homo sapiens
Locus chr16:3222049-3222120 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-CGG-1-2
HGNC Symbol TRP-CGG1-2
RNAcentral ID URS00000C18F2_9606
tRNAscan-SE ID chr16.trna7
GtRNAdb 2009
Legacy Name and Score
chr16.trna6-ProCGG (76.52 bits)
Predicted tRNA Isotype / Anticodon Pro CGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.0 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 2
Upstream / Downstream Sequence GCGGAAATACACGCACGGGA / TAGAAGTGGTTACTTTTCCC
Intron None
Possible Pseudogene No
Gene Score 70.2
Mature tRNA Score 70.2
HMM Score 43.80
Secondary Structure Score 26.40
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTCGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUCGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.039.8-8.853.450.951.850.961.958.627.419.0-3.928.04.7121.0No Hit4.756.650.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (12)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
9 (Acceptor-D-arm-linker)chr16:3222057rs148821785G / ANoYessubstitution in loop
37 (Anticodon Loop)chr16:3222084rs142589446G / CNoYessubstitution in loop
46 (Variable Loop)chr16:3222093rs774839319G / ANoNosubstitution in loop
48 (Variable Loop)chr16:3222095rs554590438C / TNoYessubstitution in loop
56 (T-Psi-C Loop)chr16:3222103rs574628759C / TNoYesuniversal base change
62 (3′ T-arm)chr16:3222109rs150958924C / GNoYesbase pair mismatch
63 (3′ T-arm)chr16:3222110rs556784427C / TNoYesGU base pair
64 (3′ T-arm)chr16:3222111rs548045356G / ANoYesbase pair mismatch
64 (3′ T-arm)chr16:3222111rs548045356G / CNoYesbase pair mismatch
65 (3′ T-arm)chr16:3222112rs372367615G / ANoYesbase pair mismatch
66 (3′ Acceptor Stem)chr16:3222113rs757218313- / TNoNorepair bulge
68 (3′ Acceptor Stem)chr16:3222115rs558988016G / ANoYesbase pair mismatch
Expression Profiles