Gene: tRNA-Ser-GCT-1-1

Overview
Organism Homo sapiens
Locus chr6:27065085-27065166 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Ser-GCT-1-1
HGNC Symbol TRS-GCT1-1
RNAcentral ID URS000047EBB5_9606
tRNAscan-SE ID chr6.trna32
GtRNAdb 2009
Legacy Name and Score
chr6.trna31-SerGCT (88.12 bits)
Predicted tRNA Isotype / Anticodon Ser GCT
Top Scoring / Second Best Scoring Isotype Model Ser (129.8 bits) / Leu (96.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 6
Upstream / Downstream Sequence CGGGAAACGTGGGTTATCAA / GGGGAGGTCTTTTAATACGA
Intron None
Possible Pseudogene No
Gene Score 91.9
Mature tRNA Score 91.9
HMM Score 63.40
Secondary Structure Score 28.50
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GACGAGGTGGCCGAGTGGTtAAGGCGATGGACTGCTAATCCATTGTGCTCTGCACGCGTGGGTTCGAATCCCACCCTCGTCG
Secondary Structure (nested bp)
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<.>>>>...<<<<..>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCACCCUCGUCG
Alignments
Ser tRNAs
>>>>>>>....>>>.............<<<.>>>>>.......<<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<<<<.... GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TTT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-1-1 Sc: 90.3 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-2-1 Sc: 89.6 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-2-2 Sc: 89.6 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-2-3 Sc: 89.6 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-2-4 Sc: 89.6 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-2-5 Sc: 89.6 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-2-6 Sc: 89.6 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TTT.....CCCCACGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-3-1 Sc: 87.2 >>>>>>>....>>>.............<<<.>>>>.........<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<<<<.... GTAGTCG..TGGCCGAGT..GGTtA.AGGTGATGGACTAGAAACCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-AGA-4-1 Sc: 78.8 >>>>>>>....>>>.............<<<.>>>>>.......<<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<<<<.... GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TTT.....CCCCACGCAGGTTCGAATCCTGC.CGACTACG... DS9991_AGA_HUMAN_CY GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTAGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... DS9992_AGA_HUMAN_CY >>>>>>>....>>>.............<<<.>>>>>.......<<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<<<<.... GCTGTGA..TGGCCGAGT..GGTtA.AGGCGTTGGACTCGAAATCCAAT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.TCACAGCG... tRNA-Ser-CGA-1-1 Sc: 95.1 GCTGTGA..TGGCCGAGT..GGTtA.AGGTGTTGGACTCGAAATCCAATGGGGG...TT......CCCCGCGCAGGTTCAAATCCTGC.TCACAGCG... tRNA-Ser-CGA-3-1 Sc: 94.6 GCTGTGA..TGGCCGAGT..GGTtA.AGGCGTTGGACTCGAAATCCAAT.GGGG...TCT.....CCCCGCGCAGGTTCAAATCCTGC.TCACAGCG... tRNA-Ser-CGA-2-1 Sc: 94.0 GTCACGG..TGGCCGAGT..GGTtA.AGGCGTTGGACTCGAAATCCAAT.GGGG...TTT.....CCCCGCACAGGTTCGAATCCTGT.TCGTGACG... tRNA-Ser-CGA-4-1 Sc: 89.6 >>>>>>>....>>>.............<<<.>>>>>.......<<<<<..>.>>>.........<<<.<..>>>>>.......<<<<<.<<<<<<<.... GGAGATA..TGGCACAATCtGGT.A.CTGCAACGGACTCGAAATCCGTCGAGCCGCGTTT....CGGGTGTGCGGGTTCAAATCCCGC.TATCTCCT... DS9994_CGA_HUMAN_CY >>>>>>>....>>>.............<<<.>>>>>.......<<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<<<<.... GCAGCGA..TGGCCGAGT..GGTtA.AGGCGTTGGACTTGAAATCCAAT.GGGG...TCT.....CCCCGCGCAGGTTCGAACCCTGC.TCGCTGCG... tRNA-Ser-TGA-1-1 Sc: 94.0 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTTGAAATCCATT.GGGG...TTT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-TGA-2-1 Sc: 90.4 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTTGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... tRNA-Ser-TGA-3-1 Sc: 89.7 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTTGAAATCCATT.GGGG...TTT.....CCCCGCGCAGGTTCGAATCCTGT.CGGCTACG... tRNA-Ser-TGA-4-1 Sc: 84.0 GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTTGAAATCCATT.GGGG...TTT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACG... DS9990_TGA_HUMAN_CY GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTTGAAATCCATT.GGGG...TTT.....CCCCGCGCAGGTTCGAATCCTGT.CGGCTACG... DS9993_TGA_HUMAN_CY GTAGTCG..TGGCCGAGT..GGTtA.AGGCGATGGACTTGAAATCCATT.GGGG...TCT.....CCCCGCGCAGGTTCGAATCCTGC.CGACTACGcca RS9991_TGA_HUMAN_CY >>>>>>>....>>>.............<<<.>>>>>.......<<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<<<<.... GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACGCGTGGGTTCGAATCCCAC.CCTCGTCG... tRNA-Ser-GCT-1-1 Sc: 91.9 GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACGCGTGGGTTCGAATCCCAC.CTTCGTCG... tRNA-Ser-GCT-2-1 Sc: 91.0 GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TTT.....GCACGCGTGGGTTCGAATCCCAT.CCTCGTCG... tRNA-Ser-GCT-3-1 Sc: 89.1 GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACGCGTGGGTTCGAATCCCAT.CCTCGTCG... tRNA-Ser-GCT-4-1 Sc: 88.4 GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACGCGTGGGTTCGAATCCCAT.CCTCGTCG... tRNA-Ser-GCT-4-2 Sc: 88.4 GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACGCGTGGGTTCGAATCCCAT.CCTCGTCG... tRNA-Ser-GCT-4-3 Sc: 88.4 GACGAGG..TGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACACGTGGGTTCGAATCCCAT.CCTCGTCG... tRNA-Ser-GCT-5-1 Sc: 85.2 >>.>>>>....>>>.............<<<.>>>>>.......<<<<<..>>>>...........<<<<..>>>>>.......<<<<<.<<<<.<<.... GGAGAGGccTGGCCGAGT..GGTtA.AGGCGATGGACTGCTAATCCATT.GTGC...TCT.....GCACGCGTGGGTTCGAATCCCAT.CCTCGTCG... tRNA-Ser-GCT-6-1 Sc: 71.6
>>>>.>>>..>>>...........<<<.>>>>>.......<<<<<.>>...........<<..>>>>>.......<<<<<.<<<<<<<. GTGAgTTGTAGCTGAGTGGTtA.AGGCAACGAGCTAGAAATTCGTTGGTTTCT....CTCTGTGCAGGTTTGAATCCTGC.TAATTATG tRNA-Ser-AGA-6-1 Sc: 34.5 (filtered) best isotype model: Ser Sc: 47.3
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
45.363.331.220.957.647.321.035.861.957.096.425.619.77.16.3-20.1129.857.850.057.324.2No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo Hit-4.7No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit0.1No Hit

Top score2nd highest score3rd highest score
DNA Variants (12)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
4 (5′ Acceptor Stem)chr6:27065088rs374749126G / ANoNobase pair mismatch
11 (5′ D-arm)chr6:27065095rs185394001C / TNoYesGU base pair
16 (D-loop)chr6:27065100rs747026475T / GNoNosubstitution in loop
42 (3′ Anticodon Stem)chr6:27065126rs554019260A / GNoYesGU base pair
43 (3′ Anticodon Stem)chr6:27065127rs141697533T / CNoYesbase pair mismatch
e2 (Variable Stem)chr6:27065134rs768969847C / ANoNosubstitution in loop
e24 (Variable Stem)chr6:27065136rs545837273G / ANoYesbase pair mismatch
e21 (Variable Stem)chr6:27065139rs771454247C / GNoNobase pair mismatch
49 (5′ T-arm)chr6:27065142rs562915878G / CNoYesbase pair mismatch
51 (5′ T-arm)chr6:27065144rs530688203G / ANoYesbase pair mismatch
69 (3′ Acceptor Stem)chr6:27065162rs776585549C / TNoNoGU base pair
72 (3′ Acceptor Stem)chr6:27065165rs569703026C / TNoNoGU base pair
Expression Profiles