Gene: tRNA-Thr-AGT-5-1

Overview
Organism Homo sapiens
Locus chr17:8042770-8042843 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Thr-AGT-5-1
HGNC Symbol TRT-AGT5-1
RNAcentral ID URS000023FFA7_9606
tRNAscan-SE ID chr17.trna39
GtRNAdb 2009
Legacy Name and Score
chr17.trna40-ThrAGT (81.60 bits)
Predicted tRNA Isotype / Anticodon Thr AGT
Top Scoring / Second Best Scoring Isotype Model Thr (101.8 bits) / Arg (80.2 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 5 out of 7
Upstream / Downstream Sequence AGGAACACCTGTTTTACGCC / GAGTTAGCGGGGAGTGATAT
Intron None
Possible Pseudogene No
Gene Score 80.1
Mature tRNA Score 80.1
HMM Score 59.10
Secondary Structure Score 21.00
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCGCCGTGGCTTAGCTGGTtAAAGCGCCTGTCTAGTAAACAGGAGAtCCTGGGTTCGAATCCCAGCGGTGCCT
Secondary Structure (nested bp)
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCGCCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGGUGCCU
Alignments
Thr tRNAs
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-1 Sc: 82.6 GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-2 Sc: 82.6 GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-3 Sc: 82.6 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-2-1 Sc: 81.4 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-2-2 Sc: 81.4 GGCTTCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGAGGCCT tRNA-Thr-AGT-4-1 Sc: 81.2 GGCTCCGTAGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGACTCCCAG.CGGGGCCT tRNA-Thr-AGT-3-1 Sc: 80.7 GGCCCTGTGGCTTAGCTGGTcA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-6-1 Sc: 80.6 GGCGCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-5-1 Sc: 80.1 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT DT9992_AGT_HUMAN_CY >>>>>>>..>>>............<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCGGTGGCCAAGT.GGT.A.AGGCGTCGGTCTCGTAAACC.GAAG...........AtCACGGGTTCGAACCCCGT.CCGTGCCT tRNA-Thr-CGT-2-1 Sc: 79.6 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCTATGGCTTAGTTGGTtA.AAGCGCCTGTCTCGTAAACA.GGAG...........AtCCTGGGTTCGACTCCCAG.TGGGGCCT tRNA-Thr-CGT-1-1 Sc: 78.4 >>>>>>>..>>>............<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCGGTGGCCAAGT.GGT.A.AGGCGTCGGTCTCGTAAACC.GAAG...........AtCGCGGGTTCGAACCCCGT.CCGTGCCT tRNA-Thr-CGT-4-1 Sc: 78.3 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCTGTGGCTTAGTTGGCtA.AAGCGCCTGTCTCGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-CGT-3-1 Sc: 77.1 GGCCCTGTAGCTCAGC.GGTtG.GAGCGCTGGTCTCGTAAACCtAGGG...........GtCGTGAGTTCAAATCTCAC.CAGGGCCT tRNA-Thr-CGT-5-1 Sc: 66.2 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCCATAGCTCAGT.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCGATCCTCGC.TGGGGCCT tRNA-Thr-TGT-2-1 Sc: 84.1 GGCTCTATGGCTTAGTTGGTtA.AAGCGCCTGTCTTGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.TAGAGCCT tRNA-Thr-TGT-1-1 Sc: 83.3 GGCTCCATAGCTCAGG.GGTtA.GAGCGCTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAATTCTCGC.TGGGGCCT tRNA-Thr-TGT-3-1 Sc: 80.0 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-4-1 Sc: 78.8 GGCCCTATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-5-1 Sc: 78.0 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGG............GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-6-1 Sc: 75.7 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAATTCTCGC.TGGGGCTT DT9990_TGT_HUMAN_CY GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT DT9991_TGT_HUMAN_CY
.>>>>>>..>>>>.................<<<<.>>>>>.........<<<<<.................>>............<<....<<<<<<.. AGCACCATGGCTTAGC....TGGTtA....AAGCACCTGTCTAGTA..AACAGGAG...........AtCCTGAGtTTCAATT.CCA..A.TGGTGCCT tRNA-Thr-AGT-7-1 Sc: 44.3 (filtered) best isotype model: Thr Sc: 59.9 >>>>>>>..>>>>.................<<<<.>>>>>.........<<<<<................>>>>..........<<<..<.<<<<<<<. GGCTCTGTGGCTTTGT....GGGTtA....AAGTACTTGTCTGGCA..AACAGGAG...........AtGCTGGAtTTCAATC.CCA..G.CAGGGCCT tRX-Ala-NNN-3-1 Sc: 37.8 (filtered) best isotype model: Thr Sc: 50.2 >>>>>>>..>>>>.................<<<<...>>...........<<..................>>>>>........<<<<..<.<<<<<<<. GGCAGTGTGGCATAGT.....GGTtAgaa.ATGTGC.GCTCTGGGG..CTGC..TG...........AtCCCAGG.CTCAAACCCTG..G.CGCTGTCA tRNA-Pro-GGG-1-1 Sc: 25.9 (filtered) best isotype model: Thr Sc: 20.6 >>>>>.>..>>.>.................<.<<.>>>.>.........<.<<<..................>>>........<<<.....<.<<<<<. GTGTGTATAGCACAGTgcagTGGT.A....GAGCACTTGCTTCTAAgaCGAAAGA............A.CCTGAG.TTCAAGTCTCTacT.TTCACACT tRX-Und-NNN-6-1 Sc: 20.5 (filtered) best isotype model: Thr Sc: 18.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
60.880.268.333.261.163.324.038.059.861.837.638.269.638.942.8No Hit42.0101.863.853.564.62.9
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (16)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr17:8042843rs761371669G / ANoNobase pair mismatch
2 (5′ Acceptor Stem)chr17:8042842rs540935934G / ANoYesbase pair mismatch
4 (5′ Acceptor Stem)chr17:8042840rs183940209G / ANoYesrestore Watson-Crick base pair
28 (5′ Anticodon Stem)chr17:8042815rs564520441C / TNoYesGU base pair
42 (3′ Anticodon Stem)chr17:8042801rs746370005G / ANoNobase pair mismatch
45 (Variable Loop)chr17:8042798rs753562496G / ANoNosubstitution in loop
48 (Variable Loop)chr17:8042795rs543147958C / TNoYessubstitution in loop
49 (5′ T-arm)chr17:8042794rs560806461C / TNoNoGU base pair
51 (5′ T-arm)chr17:8042792rs139574757G / CNoYesbase pair mismatch
51 (5′ T-arm)chr17:8042792rs139574757G / ANoYesbase pair mismatch
52 (5′ T-arm)chr17:8042791rs745436104- / TNoNorepair bulge
56 (T-Psi-C Loop)chr17:8042787rs190969375C / TNoYesuniversal base change
57 (T-Psi-C Loop)chr17:8042786rs575112770G / CNoNosubstitution in loop
68 (3′ Acceptor Stem)chr17:8042775rs542414466G / ANoYesbase pair mismatch
69 (3′ Acceptor Stem)chr17:8042774rs768263628T / ANoNobase pair mismatch
70 (3′ Acceptor Stem)chr17:8042773rs76704853G / TNoYesbase pair mismatch
Expression Profiles