Gene: tRNA-Thr-CGT-4-1

Overview
Organism Homo sapiens
Locus chr17:29877093-29877164 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Thr-CGT-4-1
HGNC Symbol TRT-CGT4-1
RNAcentral ID URS00002D4542_9606
tRNAscan-SE ID chr17.trna12
GtRNAdb 2009
Legacy Name and Score
chr17.trna14-ThrCGT (79.77 bits)
Predicted tRNA Isotype / Anticodon Thr CGT
Top Scoring / Second Best Scoring Isotype Model Thr (93.8 bits) / Arg (80.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 4 out of 6
Upstream / Downstream Sequence CACCGGTCCCTGGGCTGTCA / GAGACCCGAGGTAGGGCTTT
Intron None
Possible Pseudogene No
Gene Score 78.3
Mature tRNA Score 78.3
HMM Score 58.20
Secondary Structure Score 20.10
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GGCGCGGTGGCCAAGTGGTAAGGCGTCGGTCTCGTAAACCGAAGAtCGCGGGTTCGAACCCCGTCCGTGCCT
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCGCGGUGGCCAAGUGGUAAGGCGUCGGUCUCGUAAACCGAAGAUCGCGGGUUCGAACCCCGUCCGUGCCU
Alignments
Thr tRNAs
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-1 Sc: 82.6 GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-2 Sc: 82.6 GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-3 Sc: 82.6 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-2-1 Sc: 81.4 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-2-2 Sc: 81.4 GGCTTCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGAGGCCT tRNA-Thr-AGT-4-1 Sc: 81.2 GGCTCCGTAGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGACTCCCAG.CGGGGCCT tRNA-Thr-AGT-3-1 Sc: 80.7 GGCCCTGTGGCTTAGCTGGTcA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-6-1 Sc: 80.6 GGCGCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-5-1 Sc: 80.1 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT DT9992_AGT_HUMAN_CY >>>>>>>..>>>............<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCGGTGGCCAAGT.GGT.A.AGGCGTCGGTCTCGTAAACC.GAAG...........AtCACGGGTTCGAACCCCGT.CCGTGCCT tRNA-Thr-CGT-2-1 Sc: 79.6 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCTATGGCTTAGTTGGTtA.AAGCGCCTGTCTCGTAAACA.GGAG...........AtCCTGGGTTCGACTCCCAG.TGGGGCCT tRNA-Thr-CGT-1-1 Sc: 78.4 >>>>>>>..>>>............<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCGGTGGCCAAGT.GGT.A.AGGCGTCGGTCTCGTAAACC.GAAG...........AtCGCGGGTTCGAACCCCGT.CCGTGCCT tRNA-Thr-CGT-4-1 Sc: 78.3 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCTGTGGCTTAGTTGGCtA.AAGCGCCTGTCTCGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-CGT-3-1 Sc: 77.1 GGCCCTGTAGCTCAGC.GGTtG.GAGCGCTGGTCTCGTAAACCtAGGG...........GtCGTGAGTTCAAATCTCAC.CAGGGCCT tRNA-Thr-CGT-5-1 Sc: 66.2 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCCATAGCTCAGT.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCGATCCTCGC.TGGGGCCT tRNA-Thr-TGT-2-1 Sc: 84.1 GGCTCTATGGCTTAGTTGGTtA.AAGCGCCTGTCTTGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.TAGAGCCT tRNA-Thr-TGT-1-1 Sc: 83.3 GGCTCCATAGCTCAGG.GGTtA.GAGCGCTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAATTCTCGC.TGGGGCCT tRNA-Thr-TGT-3-1 Sc: 80.0 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-4-1 Sc: 78.8 GGCCCTATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-5-1 Sc: 78.0 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGG............GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-6-1 Sc: 75.7 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAATTCTCGC.TGGGGCTT DT9990_TGT_HUMAN_CY GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT DT9991_TGT_HUMAN_CY
.>>>>>>..>>>>.................<<<<.>>>>>.........<<<<<.................>>............<<....<<<<<<.. AGCACCATGGCTTAGC....TGGTtA....AAGCACCTGTCTAGTA..AACAGGAG...........AtCCTGAGtTTCAATT.CCA..A.TGGTGCCT tRNA-Thr-AGT-7-1 Sc: 44.3 (filtered) best isotype model: Thr Sc: 59.9 >>>>>>>..>>>>.................<<<<.>>>>>.........<<<<<................>>>>..........<<<..<.<<<<<<<. GGCTCTGTGGCTTTGT....GGGTtA....AAGTACTTGTCTGGCA..AACAGGAG...........AtGCTGGAtTTCAATC.CCA..G.CAGGGCCT tRX-Ala-NNN-3-1 Sc: 37.8 (filtered) best isotype model: Thr Sc: 50.2 >>>>>>>..>>>>.................<<<<...>>...........<<..................>>>>>........<<<<..<.<<<<<<<. GGCAGTGTGGCATAGT.....GGTtAgaa.ATGTGC.GCTCTGGGG..CTGC..TG...........AtCCCAGG.CTCAAACCCTG..G.CGCTGTCA tRNA-Pro-GGG-1-1 Sc: 25.9 (filtered) best isotype model: Thr Sc: 20.6 >>>>>.>..>>.>.................<.<<.>>>.>.........<.<<<..................>>>........<<<.....<.<<<<<. GTGTGTATAGCACAGTgcagTGGT.A....GAGCACTTGCTTCTAAgaCGAAAGA............A.CCTGAG.TTCAAGTCTCTacT.TTCACACT tRX-Und-NNN-6-1 Sc: 20.5 (filtered) best isotype model: Thr Sc: 18.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
49.680.465.329.462.259.517.536.763.269.246.432.957.629.736.7No Hit56.993.878.356.961.60.1
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo Hit-13.2No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-12.1No Hit

Top score2nd highest score3rd highest score
DNA Variants (4)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
39 (3′ Anticodon Stem)chr17:29877130rs866187366A / GNoNoGU base pair
44 (Variable Loop)chr17:29877135rs557247687A / TNoYessubstitution in loop
50 (5′ T-arm)chr17:29877141rs575764901C / TNoYesGU base pair
64 (3′ T-arm)chr17:29877155rs542767513G / ANoYesbase pair mismatch
Expression Profiles