Gene: tRNA-Trp-CCA-3-3

Overview
Organism Homo sapiens
Locus chr17:8089676-8089747 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Trp-CCA-3-3
HGNC Symbol TRW-CCA3-3
RNAcentral ID URS0000222FD2_9606
tRNAscan-SE ID chr17.trna5
GtRNAdb 2009
Legacy Name and Score
chr17.trna6-TrpCCA (74.00 bits)
Predicted tRNA Isotype / Anticodon Trp CCA
Top Scoring / Second Best Scoring Isotype Model Trp (106.9 bits) / Arg (80.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 5
Upstream / Downstream Sequence GAGCTGCCGAGTGGCCGGCC / GCGGCTATTTTTCTTCGGTT
Intron None
Possible Pseudogene No
Gene Score 73.3
Mature tRNA Score 73.3
HMM Score 50.60
Secondary Structure Score 22.70
Atypical Features None
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
GACCTCGTGGCGCAACGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCAAATCACGTCGGGGTCA
Secondary Structure (nested bp)
>>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA
Alignments
Trp tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GACCTCGTGGCGCAATGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAGTCACGTCGGGGTCA tRNA-Trp-CCA-2-1 Sc: 75.1 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GcTGCGTGTTCGAATCACGTCGGGGTCA tRNA-Trp-CCA-4-1 Sc: 74.3 GGCCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-1-1 Sc: 73.4 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-1 Sc: 73.3 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-2 Sc: 73.3 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-3 Sc: 73.3 GACCTCGTGGCGCAACGGCA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-5-1 Sc: 68.8
>>>>>>...>>>>........<<<<.>>>>>.......<<<<<................>>.>>.......<<.<<.<<<<<<. GGCCTCATGGTGCAACAGTA.GTGTGTCTGACTCCAGATCAGAAG...........GtTGTATGTTCAAATCACGTAGGGGTCA tRX-Trp-NNN-1-1 Sc: 30.6 (filtered) best isotype model: Trp Sc: 53.9
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
41.980.457.7No Hit66.533.8No Hit39.955.763.120.844.449.432.830.2No Hit22.068.3106.951.438.9-9.4
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (7)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr17:8089676rs571530148G / ANoYesbase pair mismatch
13 (5′ D-arm)chr17:8089688rs749482362C / ANoNobase pair mismatch
28 (5′ Anticodon Stem)chr17:8089702rs771885203C / GNoNobase pair mismatch
32 (Anticodon Loop)chr17:8089706rs539060891C / TNoYessubstitution in loop
40 (3′ Anticodon Stem)chr17:8089714rs772752299C / GNoNobase pair mismatch
62 (3′ T-arm)chr17:8089736rs771114899A / GNoNoGU base pair
63 (3′ T-arm)chr17:8089737rs554138527C / TNoYesGU base pair
Expression Profiles