Gene: tRNA-Tyr-GTA-3-1

Overview
Organism Homo sapiens
Locus chr6:26577332-26577420 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Tyr-GTA-3-1
HGNC Symbol TRY-GTA3-1
RNAcentral ID URS0000758799_9606
tRNAscan-SE ID chr6.trna16
GtRNAdb 2009
Legacy Name and Score
chr6.trna16-TyrGTA (77.01 bits)
Predicted tRNA Isotype / Anticodon Tyr GTA
Top Scoring / Second Best Scoring Isotype Model Tyr (118.4 bits) / Phe (79.6 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 11
Upstream / Downstream Sequence AAAAGGACAGCGTTCCGTGT / CGGTAGTTTTGACCTACCAA
Intron 38-53 (26577369-26577384)
Possible Pseudogene No
Gene Score 77.5
Mature tRNA Score 85.1
HMM Score 51.40
Secondary Structure Score 26.10
Atypical Features None
Known Modifications (Modomics) m2G10 D16 D17 acp3U20 m2,2G26 m2,2G27 galQtRNA34 Ψ35 m1G37 m1Ψ39 m2G6 m7G46 D47 m5C48 m5U54 Ψ55 m1A58
Genome Browser View with Related Data Tracks Zoomed in (750 bp flanking features)
Zoomed out (750 kbp flanking features)
Sequence
Genomic Sequence
CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGgctcattaagcaaggtATCCTTAGGtCGCTGGTTCGAATCCGGCTCGGAGGA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......................<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
CCUUCGAUAGCUCAGUUGGUAGAGCGGAGGACUGUAGAUCCUUAGGUCGCUGGUUCGAAUCCGGCUCGGAGGA
Alignments
Tyr tRNAs
>>>>>>>..>>>>........<<<<.>>>>>............................<<<<<................>>>>>.......<<<<<<<<<<<<.... CCTTCAATAGTTCAGCTGGTAGAGCAGAGGACTATAGctacttcctcagtaggagac.GTCCTTAG...........GtTGCTGGTTCGATTCCAGCTTGAAGGA... tRNA-Tyr-ATA-1-1 Sc: 57.6 >>>>>>>..>>>>........<<<<.>>>>>............................<<<<<................>>>>>.......<<<<<<<<<<<<.... CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGttggctgtgtccttagac...ATCCTTAG...........GtCGCTGGTTCGAATCCGGCTCGAAGGA... tRNA-Tyr-GTA-1-1 Sc: 77.9 CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggatagggcgtggca.....ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-2-1 Sc: 77.9 CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGgctcattaagcaaggt.....ATCCTTAG...........GtCGCTGGTTCGAATCCGGCTCGGAGGA... tRNA-Tyr-GTA-3-1 Sc: 77.5 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGgcgcgcgcccgtggcc.....ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-5-2 Sc: 75.5 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGtacttaatgtgtggtc.....ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-5-5 Sc: 75.5 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGattgtatagacatttgcggacATCCTTAG...........GtCGCTGGTTCGATTCCAGCTCGAAGGA... tRNA-Tyr-GTA-4-1 Sc: 75.3 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGctacttcctcagcaggagac.ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-5-1 Sc: 75.3 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGcctgtagaaacatttgtggacATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-5-3 Sc: 75.3 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGattgtacagacatttgcggacATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-5-4 Sc: 75.3 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGgggtttgaatgtggtc.....ATCCTTAG...........GtCGCTGGTTCGAATCCGGCTCGGAGGA... tRNA-Tyr-GTA-6-1 Sc: 75.1 CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGactgcggaaacgtttgtggacATCCTTAG...........GtCGCTGGTTCAATTCCGGCTCGAAGGA... tRNA-Tyr-GTA-7-1 Sc: 74.3 CTTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGgttcattaaactaaggc....ATCCTTAG...........GtCGCTGGTTCGAATCCGGCTCGAAGGA... tRNA-Tyr-GTA-8-1 Sc: 72.4 >>>>>>>..>>>>........<<<<.>>>>>............................<<<<<................>.>>>.......<<<.<<<<<<<<.... TCTTCAATAGCTCAGCTGGTAGAGCGGAGGACTGTAGgtgcacgcccgtggcc.....ATTCTTAG...........G.TGCTGGTTTGATTCCGACTTGGAGAG... tRNA-Tyr-GTA-9-1 Sc: 52.0 >>>>>>>..>>>>........<<<<.>>>>>............................<<<<<................>>>>>.......<<<<<<<<<<<<.... CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAG.....................ATCCTTAG...........GtCGCTGGTTCAATTCCGGCTCGAAGGA... DY9990_GTA_HUMAN_CY CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAG.....................ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGA... DY9991_GTA_HUMAN_CY CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAG.....................ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGAcca RY9990_GTA_HUMAN_PLACENTA CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAG.....................ATCCTTAG...........GtCGCTGGTTCGATTCCGGCTCGAAGGAcca RY9991_GTA_HUMAN_PLACENTA
>>>>>.>..>.>>........<<.<.>>>>>...................<<<<<................>>.>>.......<<.<<..<.<<<<<. TCTTTGAgAGATCAGCTGATAGAGTGGAGGACTGTACacatctgtggacATCCTTAG...........GtTGCTGGTTCAATTCCTGC.tTGAGGGAA tRX-Tyr-NNN-1-1 Sc: 22.8 (filtered) best isotype model: Tyr Sc: 30.5
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
34.055.258.916.276.545.1-0.431.954.661.76.056.459.679.619.8No Hit10.975.855.3118.451.96.3
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo Hit-14.8No HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit33.1No HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (13)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
13 (5′ D-arm)chr6:26577344rs569721137C / TNoYesGU base pair
34 (Anticodon Loop)chr6:26577365rs771476762G / ANoNosynonymous anticodon change
()chr6:26577369rs553782580G / CNoYesintron
()chr6:26577370rs12663894C / TYesYesintron
()chr6:26577382rs746547392G / ANoNointron
42 (3′ Anticodon Stem)chr6:26577389rs545922859T / CNoYesbase pair mismatch
43 (3′ Anticodon Stem)chr6:26577390rs562463752T / CNoYesrestore Watson-Crick base pair
43 (3′ Anticodon Stem)chr6:26577390rs562463752T / GNoYesbase pair mismatch
53 (5′ T-arm)chr6:26577400rs768112223G / TNoNobase pair mismatch
54 (T-Psi-C Loop)chr6:26577401rs76864766T / CNoYesuniversal base change
56 (T-Psi-C Loop)chr6:26577403rs761498051C / TNoNouniversal base change
64 (3′ T-arm)chr6:26577411rs764779877G / ANoNobase pair mismatch
67 (3′ Acceptor Stem)chr6:26577414rs74595947C / TNoYesGU base pair
Expression Profiles