Gene: tRNA-Arg-CCG-1-1

Overview
Organism Homo sapiens
Locus chr6:28742952-28743024 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Arg-CCG-1-1
HGNC Symbol TRR-CCG1-1
RNAcentral ID URS00001D909A_9606
tRNAscan-SE ID chr6.trna122
GtRNAdb 2009
Legacy Name and Score
chr6.trna114-ArgCCG (69.88 bits)
Predicted tRNA Isotype / Anticodon Arg CCG
Top Scoring / Second Best Scoring Isotype Model Arg (100.7 bits) / Thr (66.3 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 2
Upstream / Downstream Sequence GCAAATTAGCACCCGCGTGC / TGTTCTTACTATTGTCAGGA
Intron None
Possible Pseudogene No
Gene Score 67.0
Mature tRNA Score 67.0
HMM Score 49.40
Secondary Structure Score 17.60
Atypical Features None
Sequence
Genomic Sequence
GGCCGCGTGGCCTAATGGAtAAGGCGTCTGATTCCGGATCAGAAGAtTGAGGGTTCGAGTCCCTTCGTGGTCG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCCGCGUGGCCUAAUGGAUAAGGCGUCUGAUUCCGGAUCAGAAGAUUGAGGGUUCGAGUCCCUUCGUGGUCG
Alignments
Arg tRNAs
.>>>>>>>..>>>............<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-1 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-2 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-3 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-1 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-2 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-3 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-4 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG DR9990_ACG_HUMAN_CY .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-1 Sc: 67.0 .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-2 Sc: 67.0 .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-3 Sc: 67.0 .GACCCAGTGGCCTAATGGAt.A.AGGCATCAGCCTCCGG..................AGCTGGGG...........AtTGTGGGTTCGAGTCCCATCTGGGTCG tRNA-Arg-CCG-2-1 Sc: 64.9 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGCAGGTTCGAGTCCTGCCGCGGTCG tRNA-Arg-TCG-1-1 Sc: 74.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTCCGTGGTTA tRNA-Arg-TCG-2-1 Sc: 70.3 .GACCGCGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-TCG-3-1 Sc: 68.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTTA tRNA-Arg-TCG-4-1 Sc: 66.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTTG tRNA-Arg-TCG-5-1 Sc: 65.5 .>>>>>>>..>>>>..........<<<<.>.>>>.........................<<<.<................>>>>>.......<<<<<<<<<<<<. .GGCCGTGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAAAAG...........AtTGCAGGTTTGAGTTCTGCCACGGTCG tRNA-Arg-TCG-6-1 Sc: 53.7 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. gGACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTT. DR9991_TCG_HUMAN_CY .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GCCCCAGTGGCCTAATGGAt.A.AGGCACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCTGGGGTA tRNA-Arg-CCT-1-1 Sc: 72.3 .GCCCCGGTGGCCTAATGGAt.A.AGGCATTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCCGGGGTA tRNA-Arg-CCT-3-1 Sc: 71.7 .GCCCCAGTGGCCTAATGGAt.A.AGGCACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCTGGGGTG tRNA-Arg-CCT-2-1 Sc: 71.1 .GCCCCAGTGGCCTAATGGAt.A.AGGCATTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCATCTGGGGTG tRNA-Arg-CCT-4-1 Sc: 65.6 .GCCCCAGTGGCCTGATGGAt.A.AGGTACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTTCCACCTGGGGTA tRNA-Arg-CCT-5-1 Sc: 54.7 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GTCTCTGTGGCGCAATGGAcgA.GCGCGCTGGACTTCTA..................ATCCAGAG...........GtTCCGGGTTCGAGTCCCGGCAGAGATG tRNA-Arg-TCT-4-1 Sc: 78.5 .GGCTCCGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgaggctgaaggc......ATTCAAAG...........GtTCCGGGTTCGAGTCCCGGCGGAGTCG tRNA-Arg-TCT-1-1 Sc: 71.1 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgtgacgaatagagca...ATTCAAAG...........GtTGTGGGTTCGAATCCCACCAGAGTCG tRNA-Arg-TCT-2-1 Sc: 70.8 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgatagttagagaa.....ATTCAAAG...........GtTGTGGGTTCGAGTCCCACCAGAGTCG tRNA-Arg-TCT-3-2 Sc: 70.3 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgctgagcctagtgtggtcATTCAAAG...........GtTGTGGGTTCGAGTCCCACCAGAGTCG tRNA-Arg-TCT-3-1 Sc: 70.1 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>.>>>.......<<<.<<<<<<<<. .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgcctaaatcaagag....ATTCAAAG...........GtTGCGGGTTCGAGTCCCTCCAGAGTCG tRNA-Arg-TCT-5-1 Sc: 61.4
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GACCGTGTGGCCTtAATGGAtA.AGGTGTCTGACTTCAGATCAGAAG...........AtTGAGGGTTTGAGTCCCTTTGTGGTCA tRNA-SeC-TCA-3-1 Sc: 48.8 (filtered) best isotype model: Arg Sc: 63.6 >>>>>>>..>>..............<<.>>>>>.......<<<<<................>>>>.........<<<<<<<<<<<. GGGCCAGTGGCTC.AATGGAtA.ATGCGTCTGACTAAGAATCAGAAG...........AtTCCAGCCTTGACTCCTGGCTGGCTCA tRNA-Leu-AAG-5-1 Sc: 37.7 (filtered) best isotype model: Arg Sc: 62.5 >>>>>>>..>.>>..........<<.<.>>>.>.......<.<<<................>>>>>.......<<<<<<<<<<<<. GACCATGTGGCCT.AAGGGAaA.AGACATCTCACTTTGGGTCAGAAG...........AtTGAGGGTTCAAGTCCTTTCATGGTCA tRNA-Gln-TTG-6-1 Sc: 31.7 (filtered) best isotype model: Arg Sc: 38.8 .>>>>>>..>>>............<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<.. AGGCCAGTGGCGC.AAGGGAtA.ACGTGTCTGACCACGCATCAGAAG...........AtTGTAGGTCCAGCTCCTGCCTGGCTCG tRX-Arg-NNN-1-1 Sc: 24.8 (filtered) best isotype model: Arg Sc: 37.7
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
36.3100.758.716.142.541.58.920.545.258.632.933.038.4-11.215.2No Hit32.366.365.914.539.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (30)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr6:28743024rs901308234G / TNoNobase pair mismatch
5 (5′ Acceptor Stem)chr6:28743020rs187957139G / ANoYesrestore Watson-Crick base pair
9 (Acceptor-D-arm-linker)chr6:28743016rs898043898CGGCCGCGTG / -NoNodeletion in loop
14 (D-loop)chr6:28743011rs1032910403A / GNoNouniversal base change
19 (D-loop)chr6:28743007rs1001899788G / TNoNouniversal base change
20 (D-loop)chr6:28743006rs905690115A / CNoNosubstitution in loop
25 (3′ D-arm)chr6:28743000rs182435348C / TNoYesGU base pair
26 (D-arm-Anticodon-linker)chr6:28742999rs950100762G / ANoNosubstitution in loop
31 (5′ Anticodon Stem)chr6:28742994rs947653885A / GNoNoGU base pair
32 (Anticodon Loop)chr6:28742993rs886537061T / CNoNosubstitution in loop
34 (Anticodon Loop)chr6:28742991rs1053733236C / GNoNosynonymous anticodon change
36 (Anticodon Loop)chr6:28742989rs1047829408G / CNoNonon synonymous anticodon change
40 (3′ Anticodon Stem)chr6:28742985rs372026680- / TNoNorepair bulge
40 (3′ Anticodon Stem)chr6:28742985rs370907515C / GNoNobase pair mismatch
41 (3′ Anticodon Stem)chr6:28742984rs930625165A / GNoNoGU base pair
42 (3′ Anticodon Stem)chr6:28742983rs979724131G / ANoNobase pair mismatch
49 (5′ T-arm)chr6:28742976rs909101491G / CNoNobase pair mismatch
49 (5′ T-arm)chr6:28742976rs909101491G / ANoNorestore Watson-Crick base pair
54 (T-Psi-C Loop)chr6:28742971rs141661096T / CNoYesuniversal base change
56 (T-Psi-C Loop)chr6:28742969rs9257116C / TNoYesuniversal base change
56 (T-Psi-C Loop)chr6:28742969rs9257116C / ANoYesuniversal base change
57 (T-Psi-C Loop)chr6:28742968rs950716162G / ANoNosubstitution in loop
59 (T-Psi-C Loop)chr6:28742966rs1026144339G / ANoNosubstitution in loop
60 (T-Psi-C Loop)chr6:28742965rs975014714T / CNoNosubstitution in loop
62 (3′ T-arm)chr6:28742963rs943625267C / TNoNoGU base pair
63 (3′ T-arm)chr6:28742962rs965401955C / TNoNoGU base pair
68 (3′ Acceptor Stem)chr6:28742957rs547175704T / GNoYesbase pair mismatch
69 (3′ Acceptor Stem)chr6:28742956rs912024195G / TNoNobase pair mismatch
69 (3′ Acceptor Stem)chr6:28742956rs912024195G / ANoNobase pair mismatch
72 (3′ Acceptor Stem)chr6:28742953rs1006815739C / TNoNoGU base pair