Gene: tRNA-Arg-CCG-1-2

Overview
Organism Homo sapiens
Locus chr6:28881388-28881460 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Arg-CCG-1-2
HGNC Symbol TRR-CCG1-2
RNAcentral ID URS00001D909A_9606
tRNAscan-SE ID chr6.trna75
GtRNAdb 2009
Legacy Name and Score
chr6.trna73-ArgCCG (69.88 bits)
Predicted tRNA Isotype / Anticodon Arg CCG
Top Scoring / Second Best Scoring Isotype Model Arg (100.7 bits) / Thr (66.3 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 2
Upstream / Downstream Sequence AGCATCTGTCTTTGGCGGTT / TCGTTTTGCGTTCTCTGGTT
Intron None
Possible Pseudogene No
Gene Score 67.0
Mature tRNA Score 67.0
HMM Score 49.40
Secondary Structure Score 17.60
Atypical Features None
Sequence
Genomic Sequence
GGCCGCGTGGCCTAATGGAtAAGGCGTCTGATTCCGGATCAGAAGAtTGAGGGTTCGAGTCCCTTCGTGGTCG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCCGCGUGGCCUAAUGGAUAAGGCGUCUGAUUCCGGAUCAGAAGAUUGAGGGUUCGAGUCCCUUCGUGGUCG
Alignments
Arg tRNAs
.>>>>>>>..>>>............<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-1 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-2 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-1-3 Sc: 67.6 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-1 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-2 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-3 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCTAGGTTCGACTCCTGGCTGGCTCG tRNA-Arg-ACG-2-4 Sc: 64.2 .GGGCCAGTGGCGCAATGGAt.A.ACGCGTCTGACTACGG..................ATCAGAAG...........AtTCCAGGTTCGACTCCTGGCTGGCTCG DR9990_ACG_HUMAN_CY .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-1 Sc: 67.0 .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-2 Sc: 67.0 .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGATTCCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-CCG-1-3 Sc: 67.0 .GACCCAGTGGCCTAATGGAt.A.AGGCATCAGCCTCCGG..................AGCTGGGG...........AtTGTGGGTTCGAGTCCCATCTGGGTCG tRNA-Arg-CCG-2-1 Sc: 64.9 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GGCCGCGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGCAGGTTCGAGTCCTGCCGCGGTCG tRNA-Arg-TCG-1-1 Sc: 74.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTCCGTGGTTA tRNA-Arg-TCG-2-1 Sc: 70.3 .GACCGCGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAGTCCCTTCGTGGTCG tRNA-Arg-TCG-3-1 Sc: 68.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTTA tRNA-Arg-TCG-4-1 Sc: 66.8 .GACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTTG tRNA-Arg-TCG-5-1 Sc: 65.5 .>>>>>>>..>>>>..........<<<<.>.>>>.........................<<<.<................>>>>>.......<<<<<<<<<<<<. .GGCCGTGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAAAAG...........AtTGCAGGTTTGAGTTCTGCCACGGTCG tRNA-Arg-TCG-6-1 Sc: 53.7 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. gGACCACGTGGCCTAATGGAt.A.AGGCGTCTGACTTCGG..................ATCAGAAG...........AtTGAGGGTTCGAATCCCTTCGTGGTT. DR9991_TCG_HUMAN_CY .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GCCCCAGTGGCCTAATGGAt.A.AGGCACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCTGGGGTA tRNA-Arg-CCT-1-1 Sc: 72.3 .GCCCCGGTGGCCTAATGGAt.A.AGGCATTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCCGGGGTA tRNA-Arg-CCT-3-1 Sc: 71.7 .GCCCCAGTGGCCTAATGGAt.A.AGGCACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCACCTGGGGTG tRNA-Arg-CCT-2-1 Sc: 71.1 .GCCCCAGTGGCCTAATGGAt.A.AGGCATTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTCCCATCTGGGGTG tRNA-Arg-CCT-4-1 Sc: 65.6 .GCCCCAGTGGCCTGATGGAt.A.AGGTACTGGCCTCCTA..................AGCCAGGG...........AtTGTGGGTTCGAGTTCCACCTGGGGTA tRNA-Arg-CCT-5-1 Sc: 54.7 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>>>>>.......<<<<<<<<<<<<. .GTCTCTGTGGCGCAATGGAcgA.GCGCGCTGGACTTCTA..................ATCCAGAG...........GtTCCGGGTTCGAGTCCCGGCAGAGATG tRNA-Arg-TCT-4-1 Sc: 78.5 .GGCTCCGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgaggctgaaggc......ATTCAAAG...........GtTCCGGGTTCGAGTCCCGGCGGAGTCG tRNA-Arg-TCT-1-1 Sc: 71.1 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgtgacgaatagagca...ATTCAAAG...........GtTGTGGGTTCGAATCCCACCAGAGTCG tRNA-Arg-TCT-2-1 Sc: 70.8 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgatagttagagaa.....ATTCAAAG...........GtTGTGGGTTCGAGTCCCACCAGAGTCG tRNA-Arg-TCT-3-2 Sc: 70.3 .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgctgagcctagtgtggtcATTCAAAG...........GtTGTGGGTTCGAGTCCCACCAGAGTCG tRNA-Arg-TCT-3-1 Sc: 70.1 .>>>>>>>..>>>>..........<<<<.>>>>>.........................<<<<<................>.>>>.......<<<.<<<<<<<<. .GGCTCTGTGGCGCAATGGAt.A.GCGCATTGGACTTCTAgcctaaatcaagag....ATTCAAAG...........GtTGCGGGTTCGAGTCCCTCCAGAGTCG tRNA-Arg-TCT-5-1 Sc: 61.4
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GACCGTGTGGCCTtAATGGAtA.AGGTGTCTGACTTCAGATCAGAAG...........AtTGAGGGTTTGAGTCCCTTTGTGGTCA tRNA-SeC-TCA-3-1 Sc: 48.8 (filtered) best isotype model: Arg Sc: 63.6 >>>>>>>..>>..............<<.>>>>>.......<<<<<................>>>>.........<<<<<<<<<<<. GGGCCAGTGGCTC.AATGGAtA.ATGCGTCTGACTAAGAATCAGAAG...........AtTCCAGCCTTGACTCCTGGCTGGCTCA tRNA-Leu-AAG-5-1 Sc: 37.7 (filtered) best isotype model: Arg Sc: 62.5 >>>>>>>..>.>>..........<<.<.>>>.>.......<.<<<................>>>>>.......<<<<<<<<<<<<. GACCATGTGGCCT.AAGGGAaA.AGACATCTCACTTTGGGTCAGAAG...........AtTGAGGGTTCAAGTCCTTTCATGGTCA tRNA-Gln-TTG-6-1 Sc: 31.7 (filtered) best isotype model: Arg Sc: 38.8 .>>>>>>..>>>............<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<.. AGGCCAGTGGCGC.AAGGGAtA.ACGTGTCTGACCACGCATCAGAAG...........AtTGTAGGTCCAGCTCCTGCCTGGCTCG tRX-Arg-NNN-1-1 Sc: 24.8 (filtered) best isotype model: Arg Sc: 37.7
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
36.3100.758.716.142.541.58.920.545.258.632.933.038.4-11.215.2No Hit32.366.365.914.539.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (52)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr6:28881388rs1039406457G / ANoNobase pair mismatch
1 (5′ Acceptor Stem)chr6:28881388rs1039406457G / TNoNobase pair mismatch
2 (5′ Acceptor Stem)chr6:28881389rs571694847G / CNoYesbase pair mismatch
3 (5′ Acceptor Stem)chr6:28881390rs1009753054C / TNoNoGU base pair
4 (5′ Acceptor Stem)chr6:28881391rs899607292C / ANoNobase pair mismatch
4 (5′ Acceptor Stem)chr6:28881391rs899607292C / TNoNoGU base pair
5 (5′ Acceptor Stem)chr6:28881392rs765287308G / CNoNobase pair mismatch
6 (5′ Acceptor Stem)chr6:28881393rs569114205C / GNoNobase pair mismatch
15 (D-loop)chr6:28881402rs530922458A / CNoYessubstitution in loop
16 (D-loop)chr6:28881403rs370891377T / ANoNosubstitution in loop
16 (D-loop)chr6:28881403rs370891377T / CNoNosubstitution in loop
20 (D-loop)chr6:28881406rs966072100A / CNoNosubstitution in loop
20 (D-loop)chr6:28881406rs966072100A / GNoNosubstitution in loop
20a (D-loop)chr6:28881407rs750503278T / CNoNosubstitution in loop
23 (3′ D-arm)chr6:28881410rs951260512G / ANoNobase pair mismatch
26 (D-arm-Anticodon-linker)chr6:28881413rs550657871G / TNoYessubstitution in loop
28 (5′ Anticodon Stem)chr6:28881415rs758896217C / GNoNobase pair mismatch
29 (5′ Anticodon Stem)chr6:28881416rs941107165T / CNoNobase pair mismatch
30 (5′ Anticodon Stem)chr6:28881417rs1005128003G / ANoNobase pair mismatch
30 (5′ Anticodon Stem)chr6:28881417rs1005128003G / CNoNobase pair mismatch
32 (Anticodon Loop)chr6:28881419rs539609110T / CNoNosubstitution in loop
35 (Anticodon Loop)chr6:28881422rs1015193586C / GNoNonon synonymous anticodon change
36 (Anticodon Loop)chr6:28881423rs187763979G / ANoYesnon synonymous anticodon change
37 (Anticodon Loop)chr6:28881424rs981624797G / ANoNosubstitution in loop
37 (Anticodon Loop)chr6:28881424rs981624797G / CNoNosubstitution in loop
41 (3′ Anticodon Stem)chr6:28881428rs139254710- / TNoYesrepair bulge
42 (3′ Anticodon Stem)chr6:28881429rs1034405052G / ANoNobase pair mismatch
43 (3′ Anticodon Stem)chr6:28881430rs1057091405A / TNoNobase pair mismatch
44 (Variable Loop)chr6:28881431rs768050776AGATTGAGGGTT / -NoNodeletion in loop
46 (Variable Loop)chr6:28881433rs892739833A / GNoNosubstitution in loop
47 (Variable Loop)chr6:28881434rs1010255715T / GNoNosubstitution in loop
49 (5′ T-arm)chr6:28881436rs958803399G / ANoNorestore Watson-Crick base pair
49 (5′ T-arm)chr6:28881436rs958803399G / CNoNobase pair mismatch
50 (5′ T-arm)chr6:28881437rs904054425A / CNoNobase pair mismatch
51 (5′ T-arm)chr6:28881438rs558444999G / CNoNobase pair mismatch
52 (5′ T-arm)chr6:28881439rs990662800G / ANoNobase pair mismatch
54 (T-Psi-C Loop)chr6:28881441rs1007644809T / GNoNouniversal base change
55 (T-Psi-C Loop)chr6:28881442rs1017703069T / CNoNouniversal base change
56 (T-Psi-C Loop)chr6:28881443rs536917695C / TNoYesuniversal base change
57 (T-Psi-C Loop)chr6:28881444rs946071348G / ANoNosubstitution in loop
58 (T-Psi-C Loop)chr6:28881445rs1029969970- / TNoNouniversal base change
61 (3′ T-arm)chr6:28881448rs977273978C / TNoNoGU base pair
62 (3′ T-arm)chr6:28881449rs755356581C / TNoNoGU base pair
63 (3′ T-arm)chr6:28881450rs943845833C / TNoNoGU base pair
65 (3′ T-arm)chr6:28881452rs553717673T / ANoYesbase pair mismatch
65 (3′ T-arm)chr6:28881452rs553717673T / GNoYesbase pair mismatch
66 (3′ Acceptor Stem)chr6:28881453rs899700621C / GNoNobase pair mismatch
66 (3′ Acceptor Stem)chr6:28881453rs899700621C / TNoNoGU base pair
69 (3′ Acceptor Stem)chr6:28881456rs931075344G / ANoNobase pair mismatch
70 (3′ Acceptor Stem)chr6:28881457rs567048618G / ANoYesbase pair mismatch
72 (3′ Acceptor Stem)chr6:28881459rs926389283C / TNoNoGU base pair
73 (3′ end)chr6:28881460rs1048655559G / CNoNosubstitution in loop