Gene: tRNA-Asn-GTT-11-1

Overview
Organism Homo sapiens
Locus chr1:120952291-120952364 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asn-GTT-11-1
HGNC Symbol TRN-GTT11-1
RNAcentral ID URS0000624B2D_9606
tRNAscan-SE ID chr1.trna137
GtRNAdb 2009
Legacy Name and Score
chr1.trna11-AsnGTT (60.57 bits)
Predicted tRNA Isotype / Anticodon Asn GTT
Top Scoring / Second Best Scoring Isotype Model Asn (97.1 bits) / Arg (55.7 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 11 out of 27
Upstream / Downstream Sequence CAGTGGAGTTAGCAGTGCTT / CTTATTGGAACTTTTAAAGC
Intron None
Possible Pseudogene No
Gene Score 53.5
Mature tRNA Score 53.5
HMM Score 38.90
Secondary Structure Score 14.60
Atypical Features C30:C40
Sequence
Genomic Sequence
GTCTCTGTGGTGCAATCGGTtAGCGCGTTCCGCTGTTAACCGAAAGCtTGGTGGTTCGAGCCCACCCAGGGATG
Secondary Structure (nested bp)
>>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GUCUCUGUGGUGCAAUCGGUUAGCGCGUUCCGCUGUUAACCGAAAGCUUGGUGGUUCGAGCCCACCCAGGGAUG
Alignments
Asn tRNAs
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGATCCCACCCAGGGACG... tRNA-Asn-GTT-1-1 Sc: 81.5 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-1 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-2 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-3 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-4 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-5 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-6 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-7 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-2-8 Sc: 80.9 GTCTCTGTGGCGCAATCGGTtA.GCGCATTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-3-1 Sc: 79.7 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........AtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-4-1 Sc: 77.7 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACTG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGGACG... tRNA-Asn-GTT-5-1 Sc: 76.5 GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACTG.AAAG...........GtTGGTGGTTCGAGCCCACCCGGGGACG... tRNA-Asn-GTT-9-1 Sc: 74.9 GTCTCTGTGGCGCAATGGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCATCCAGGGACG... tRNA-Asn-GTT-6-1 Sc: 73.8 >>.>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<.<<.... GTCTCTGTGGCGTAGTCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCACCCAGGAACG... tRNA-Asn-GTT-7-1 Sc: 73.5 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGCtA.GCGCGTTTGGCTGTTAACTA.AAAG...........GtTGGTGGTTCGAACCCACCCAGAGGCG... tRNA-Asn-GTT-8-1 Sc: 69.8 >>>>.>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<.<<<<.... GTCTCTGTGGCGCAGTCGGTtA.GCGCGTTCGGCTGTTAACCG.GAAG...........GtTGGTGGTTCGAGACCACCCAAGGACG... tRNA-Asn-GTT-26-1 Sc: 68.7 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<.................>>>>.......<<<<.<<<<<<<.... GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACTG.AAAG...........GtTAGTGGTTCGAGCCCACCCGGGGACG... tRNA-Asn-GTT-9-2 Sc: 68.6 >>>>>>>..>>>>..........<<<<.>.>>>.......<<<..<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.CAAG...........GtTGGTGGTTCCAGCCCACCCAGGGACG... tRNA-Asn-GTT-24-1 Sc: 67.9 >>.>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<.<<.... GTCTCTGTGGCGCAATTGGTtA.GCGCGTTCGGTTGTTAACCGtAAAG...........GtTGGTGGTTCGAGCCCACCCAGGAACG... tRNA-Asn-GTT-25-1 Sc: 64.1 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>.>>.......<<.<<<<<<<<<.... GTCTCTGTGGCGCAATCGGCtA.GCGCGTTTGGCTGTTAACTA.AAAG...........GtTGGCGGTTCGAACCCACCCAGAGGCG... tRNA-Asn-GTT-10-1 Sc: 62.7 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGCtA.GCGCTTTTGGCTGTTAACTA.AAAG...........GtTGGTGGTTTGAACCCACCCAGAGGCG... tRNA-Asn-GTT-27-1 Sc: 62.4 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>.........<<<<<<<<<<<.... GTCTCTGTGGCGCAATCGGCtA.GCGCGTTTGGCTGTTAACTA.AAAA...........GtTGGTGGTTCGAACACACCCAGAGGCG... tRNA-Asn-GTT-12-1 Sc: 54.5 >>>>>>>..>>>>..........<<<<.>>>.>.......<.<.<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGTGCAATCGGTtA.GCGCGTTCCGCTGTTAACCG.AAAG...........CtTGGTGGTTCGAGCCCACCCAGGGATG... tRNA-Asn-GTT-11-1 Sc: 53.5 GTCTCTGTGGTGCAATCGGTtA.GCGCGTTCCGCTGTTAACCG.AAAG...........CtTGGTGGTTCGAGCCCACCCAGGGATG... tRNA-Asn-GTT-11-2 Sc: 53.5 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<<<<.... GTCTCTGTGGCGCAATGGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGTTCGAGCCCATCCAGGGACG... DN9990_GTT_HUMAN_CY GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........AtTGGTGGTTCGAGCCCACCCAGGGACG... DN9991_GTT_HUMAN_CY GTCTCTGTGGCGCAATCGGTtA.GCGCGTTCGGCTGTTAACCG.AAAG...........GtTGGTGGNTCGAGCCCACCCAGGGACGcca RN9990_GTT_HUMAN_LIVER/PLAC GGTCCCATGGTGTAAT.GGTtA.GCACTCTGGACTNTGAATCC.AGCG...........A.TCCGAGTTCAAATCTCGGTGGGACCTcca RN9991_NTG_HUMAN_CY >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<<<<<<<<.... RN9991_NTG_HUMAN_CY
>>>>>>>..>>>>............<<<<.>..>>.........<<..<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGTGCAATCGGTtA...GCGCGTTCGGCTGTT..AACCATAAG...........GtTGGTGGTTAGAGACCACCCAGGGACG tRNA-Asn-GTT-13-1 Sc: 52.0 (filtered) best isotype model: Asn Sc: 89.2 >>>>>>>..>>>>............<<<<.>>>>...........<<<<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-1 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 GTCTCTGTGGCGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-3 Sc: 46.1 (filtered) best isotype model: Asn Sc: 86.5 .>>>>.>..>.>>............<<.<.>>>>>.........<<<<<................>>>>>.......<<<<<<.<<<<.. ATCTCCGTGGAGCAATTGGTtA...GCGCGTTCGGCTGTT..AACCGGAAA...........GtTGGTGGTTCGAGCCTACCCAGGGACG tRNA-Asn-GTT-15-1 Sc: 42.4 (filtered) best isotype model: Asn Sc: 86.4 ATCTCCGTGGAGCAATTGGTtA...GCGCGTTCGGCTGTT..AACCGGAAA...........GtTGGTGGTTCGAGCCTACCCAGGGACG tRNA-Asn-GTT-15-2 Sc: 42.4 (filtered) best isotype model: Asn Sc: 86.4 ATCTCCGTGGAGCAATTGGTtA...GCGCGTTCGGCTGTT..AACCGGAAA...........GtTGGTGGTTCGAGCCTACCCAGGGACG tRNA-Asn-GTT-15-3 Sc: 42.4 (filtered) best isotype model: Asn Sc: 86.4 >>>>>>>..>>>>............<<<<.>>>>...........<<<<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGTGCAATCGGTtA...GCGCGTTTGACTGTT..AACTGAAAG...........GtTGGTGGTGCAAGCCCATCCAGGGATG tRNA-Asn-GTT-16-5 Sc: 40.7 (filtered) best isotype model: Asn Sc: 82.2 >>>>>>>..>>>>............<<<<.>..>>.........<<..<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGTGCAATCGGTtA...GCGCGTTCGGCTGTT..AACCATAAG...........GtTGGTGGTTACAGACCACCCAGGGACG tRNA-Asn-GTT-18-1 Sc: 44.1 (filtered) best isotype model: Asn Sc: 82.0 .>>>>.>..>.>>............<<.<.>>>>>.........<<<<<................>>>>>.......<<<<<<.<<<<.. ATCTCCGTGGAGCAATTGGTtA...GCGCGTTCGGCCGTT..AACCGGAAA...........GtTGGTGGTTCGAGCCTACCCAGGGACG tRNA-Asn-GTT-19-1 Sc: 37.7 (filtered) best isotype model: Asn Sc: 78.0 >>>>>>>..>>.>............<.<<.>>>>>.........<<<<<.................>>.>.......<.<<.<<<<<<<. GTCTCTGTGGCGCAATCGGTcA...GAGCGTTCGGCTATT..AACCGAACG...........GtGAGTAGTTCAAGACCACCCAGGGACG tRNA-Asn-ATT-1-1 Sc: 47.8 (filtered) best isotype model: Asn Sc: 76.9 GTCTCTGTGGCGCAATCGGTcA...GAGCGTTCGGCTATT..AACCGAACG...........GtGAGTAGTTCAAGACCACCCAGGGACG tRNA-Asn-ATT-1-2 Sc: 47.8 (filtered) best isotype model: Asn Sc: 76.9 >>>>>>...>>.>............<.<<.>>.>>.........<<.<<................>>>>>.......<<<<<.<<<<<<. GTCTCTGTGGCACAATCGGTtA...GCGCGTTCGGCTGTT..AATCTAGAG...........GtTGGTGGTTAGAGCCCACTGAGGGATG tRNA-Asn-GTT-21-1 Sc: 42.4 (filtered) best isotype model: Asn Sc: 70.8 GTCTCTGTGGCACAATCGGTtA...GCGCGTTTGGCTGTT..AATCTAAAG...........TtTGGTGGTTAGAGCCCACTGAGGGACG tRX-Asn-NNN-2-1 Sc: 47.0 (filtered) best isotype model: Asn Sc: 70.3 GTCTCTGTGGCACAATCGGTtA...GCGCGTTTGGCTGTT..AATCTAAAG...........TtTGGTGGTTAGAGCCCACTGAGGGACG tRX-Asn-NNN-3-1 Sc: 47.0 (filtered) best isotype model: Asn Sc: 70.3 >>>>>>>..>>>>............<<<<.>>>>>.........<<<<<................>>>>>.......<<<<<<<<<<<<. GTCTCTGTGGCGCCATCGGTtA...GTGCCTTCGGCTGTTtgAACCGAAAG...........GcTGGTGGTTCAAGCCCACCCAGAGATG tRNA-Asn-GTT-20-1 Sc: 41.0 (filtered) best isotype model: Asn Sc: 67.9 >>>>>.>..>>>>............<<<<.>>>>...........<<<<................>>>>>.......<<<<<<.<<<<<. GTTTCTGTAGCGCGATCGGTtA...GCGCCTTCGGCTGTT..AAACGAAAG...........GtTGGTGGTTCGTTCCCACCCCGGGACA tRNA-Asn-GTT-17-1 Sc: 39.0 (filtered) best isotype model: Asn Sc: 67.6 >>>>>>...>>.>............<.<<.>>.>>.........<<.<<................>>>>>.......<<<<<.<<<<<<. GTCTCTGTGGCACAATCGGTtA...GAGCGTTCGGCTGTT..AATCTAAAG...........GtTGGTGGCTAGAACCCACTGAGGGACG tRNA-Asn-GTT-22-1 Sc: 37.2 (filtered) best isotype model: Asn Sc: 57.6 >>>>>>>..>>>>............<<<<.>>>.>.........<.<<<................>.>>>.......<<<.<<<<<<<<. GTCTCTGTTGCGCAATC....A...GCGCGTTTGGCTGTT..AACAGAAAG...........GcTGGTGGTCCGAGCCCAACCAGGGACT tRX-Asn-NNN-1-1 Sc: 20.4 (filtered) best isotype model: Asn Sc: 52.5
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
6.055.797.16.514.320.89.8-0.920.137.6No Hit40.149.311.0No HitNo Hit-6.645.530.212.954.1-14.9
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (1)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
56 (T-Psi-C Loop)chr1:120952308rs2994192C / TNoNouniversal base change