Gene: tRNA-Asp-GTC-2-1

Overview
Organism Homo sapiens
Locus chr1:161440825-161440896 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asp-GTC-2-1
HGNC Symbol TRD-GTC2-1
RNAcentral ID URS00006174C2_9606
tRNAscan-SE ID chr1.trna92
GtRNAdb 2009
Legacy Name and Score
chr1.trna81-AspGTC (72.92 bits)
Predicted tRNA Isotype / Anticodon Asp GTC
Top Scoring / Second Best Scoring Isotype Model Asp (109.9 bits) / Gly (76.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 10
Upstream / Downstream Sequence CCCGGCGACCGTCGCCGTCG / GCAGCCGTGCTTTTTGGGCC
Intron None
Possible Pseudogene No
Gene Score 66.5
Mature tRNA Score 66.5
HMM Score 35.70
Secondary Structure Score 30.80
Atypical Features None
Sequence
Genomic Sequence
TCCTCGTTAGTATAGTGGTgAGTATCCCCGCCTGTCACGCGGGAGaCCGGGGTTCGATTCCCCGACGGGGAG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAG
Alignments
Asp tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-1 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-10 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-11 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-2 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-3 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-4 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-5 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-6 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-7 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-8 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-9 Sc: 66.5 TCCTCGTTAGTATAGTGGTtA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCAATTCCCCGACGGGGAG tRNA-Asp-GTC-1-1 Sc: 65.4 TCCTCGTTAGTATAGTGGTgA.GTGTCCCCGTCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-3-1 Sc: 58.2
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>.......<<<<..<<<<<<<. TCCTCGTTAGTATGGTGGTgA.GTATCCCTGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCA.ACGGGGAG tRNA-Asp-GTC-4-1 Sc: 47.6 (filtered) best isotype model: Asp Sc: 92.3 >>>>>.>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<.<.<<<<<. TCCTCATCAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACTGGGGTTCGATTCCCTG.AGGAGGAG tRNA-Asp-GTC-5-1 Sc: 40.3 (filtered) best isotype model: Asp Sc: 82.2 >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<...............>>>>>.......<<<<<.<<<<<<<. TTCTTGTTAATATAGTGGTgA.GTATTCCCACCTGTCATGCGGGA............GACGGGGTTCAATTCCCTG.ATGGGGAG tRNA-Asp-GTC-6-1 Sc: 38.2 (filtered) best isotype model: Asp Sc: 68.8 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTgA.GTATCTCTGCCTGTCATGCGTGAG...........AGAGGGGGTCGATTCCCCG.ACGGGGAG tRNA-Asp-GTC-10-1 Sc: 23.5 (filtered) best isotype model: Asp Sc: 57.0 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>.>.......<.<<<.<<<<<<<. TCCTTGTTAGTATAGTGGTgA.GTGTTTCTGCCTGTCATGTGGAG............ACTGGAGTTTGAGTCCCCA.ACAGGGAG tRNA-Asp-GTC-8-1 Sc: 30.3 (filtered) best isotype model: Asp Sc: 53.6 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTaA.GTATCTCTGCCTGTCATGCATGAG...........AGAGGGGGTCGATTCCCTG.ACGGGGAG tRNA-Asp-GTC-9-1 Sc: 24.8 (filtered) best isotype model: Asp Sc: 53.0
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
45.145.021.3109.926.650.463.876.563.525.6No Hit13.045.2No Hit43.5-16.3No Hit56.037.926.940.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (25)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
5 (5′ Acceptor Stem)chr1:161440892rs1037442794C / GNoNobase pair mismatch
12 (5′ D-arm)chr1:161440885rs142451887A / GYesYesGU base pair
19 (D-loop)chr1:161440879rs941528441G / TNoNouniversal base change
21 (D-loop)chr1:161440876rs908677335A / GNoNouniversal base change
24 (3′ D-arm)chr1:161440873rs983361946A / GNoNoGU base pair
26 (D-arm-Anticodon-linker)chr1:161440871rs950300087C / TNoNosubstitution in loop
26 (D-arm-Anticodon-linker)chr1:161440871rs950300087C / ANoNosubstitution in loop
27 (5′ Anticodon Stem)chr1:161440870rs559295718C / TNoNoGU base pair
28 (5′ Anticodon Stem)chr1:161440869rs537174903C / ANoYesbase pair mismatch
29 (5′ Anticodon Stem)chr1:161440868rs958721795C / TNoNoGU base pair
33 (Anticodon Loop)chr1:161440864rs12731992T / CYesYesuniversal base change
34 (Anticodon Loop)chr1:161440863rs1033088761G / ANoNosynonymous anticodon change
38 (Anticodon Loop)chr1:161440859rs552366171C / TYesYessubstitution in loop
41 (3′ Anticodon Stem)chr1:161440856rs967459385G / TNoNobase pair mismatch
42 (3′ Anticodon Stem)chr1:161440855rs1020084699G / ANoNobase pair mismatch
45 (Variable Loop)chr1:161440852rs1009160685G / CNoNosubstitution in loop
45 (Variable Loop)chr1:161440852rs1009160685G / ANoNosubstitution in loop
46 (Variable Loop)chr1:161440851rs532527258A / GYesYessubstitution in loop
50 (5′ T-arm)chr1:161440848rs890356303G / TNoNobase pair mismatch
51 (5′ T-arm)chr1:161440847rs1029349418G / CNoNobase pair mismatch
53 (5′ T-arm)chr1:161440845rs995786171G / TNoNobase pair mismatch
57 (T-Psi-C Loop)chr1:161440841rs560414799G / CNoYessubstitution in loop
65 (3′ T-arm)chr1:161440833rs546935601G / CNoYesbase pair mismatch
66 (3′ Acceptor Stem)chr1:161440832rs1037332030A / TNoNobase pair mismatch
73 (3′ end)chr1:161440825rs940409999G / ANoNosubstitution in loop