Gene: tRNA-Asp-GTC-2-10

Overview
Organism Homo sapiens
Locus chr12:124939647-124939718 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asp-GTC-2-10
HGNC Symbol TRD-GTC2-10
RNAcentral ID URS00006174C2_9606
tRNAscan-SE ID chr12.trna10
GtRNAdb 2009
Legacy Name and Score
chr12.trna10-AspGTC (72.92 bits)
Predicted tRNA Isotype / Anticodon Asp GTC
Top Scoring / Second Best Scoring Isotype Model Asp (109.9 bits) / Gly (76.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 10
Upstream / Downstream Sequence AGGGAACACAGTACGGCTTG / GCCGGGTACTTTCGTATTTT
Intron None
Possible Pseudogene No
Gene Score 66.5
Mature tRNA Score 66.5
HMM Score 35.70
Secondary Structure Score 30.80
Atypical Features None
Sequence
Genomic Sequence
TCCTCGTTAGTATAGTGGTgAGTATCCCCGCCTGTCACGCGGGAGaCCGGGGTTCGATTCCCCGACGGGGAG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAG
Alignments
Asp tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-1 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-10 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-11 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-2 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-3 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-4 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-5 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-6 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-7 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-8 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-9 Sc: 66.5 TCCTCGTTAGTATAGTGGTtA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCAATTCCCCGACGGGGAG tRNA-Asp-GTC-1-1 Sc: 65.4 TCCTCGTTAGTATAGTGGTgA.GTGTCCCCGTCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-3-1 Sc: 58.2
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>.......<<<<..<<<<<<<. TCCTCGTTAGTATGGTGGTgA.GTATCCCTGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCA.ACGGGGAG tRNA-Asp-GTC-4-1 Sc: 47.6 (filtered) best isotype model: Asp Sc: 92.3 >>>>>.>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<.<.<<<<<. TCCTCATCAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACTGGGGTTCGATTCCCTG.AGGAGGAG tRNA-Asp-GTC-5-1 Sc: 40.3 (filtered) best isotype model: Asp Sc: 82.2 >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<...............>>>>>.......<<<<<.<<<<<<<. TTCTTGTTAATATAGTGGTgA.GTATTCCCACCTGTCATGCGGGA............GACGGGGTTCAATTCCCTG.ATGGGGAG tRNA-Asp-GTC-6-1 Sc: 38.2 (filtered) best isotype model: Asp Sc: 68.8 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTgA.GTATCTCTGCCTGTCATGCGTGAG...........AGAGGGGGTCGATTCCCCG.ACGGGGAG tRNA-Asp-GTC-10-1 Sc: 23.5 (filtered) best isotype model: Asp Sc: 57.0 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>.>.......<.<<<.<<<<<<<. TCCTTGTTAGTATAGTGGTgA.GTGTTTCTGCCTGTCATGTGGAG............ACTGGAGTTTGAGTCCCCA.ACAGGGAG tRNA-Asp-GTC-8-1 Sc: 30.3 (filtered) best isotype model: Asp Sc: 53.6 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTaA.GTATCTCTGCCTGTCATGCATGAG...........AGAGGGGGTCGATTCCCTG.ACGGGGAG tRNA-Asp-GTC-9-1 Sc: 24.8 (filtered) best isotype model: Asp Sc: 53.0
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
45.145.021.3109.926.650.463.876.563.525.6No Hit13.045.2No Hit43.5-16.3No Hit56.037.926.940.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (74)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
2 (5′ Acceptor Stem)chr12:124939717rs1054978907C / TNoNoGU base pair
2 (5′ Acceptor Stem)chr12:124939717rs1054978907C / GNoNobase pair mismatch
2 (5′ Acceptor Stem)chr12:124939717rs1054978907C / ANoNobase pair mismatch
3 (5′ Acceptor Stem)chr12:124939716rs936385341C / TNoNoGU base pair
4 (5′ Acceptor Stem)chr12:124939715rs997257145T / CNoNorestore Watson-Crick base pair
5 (5′ Acceptor Stem)chr12:124939714rs903605418C / TNoNoGU base pair
8 (Acceptor-D-arm-linker)chr12:124939711rs1042446343T / GNoNouniversal base change
8 (Acceptor-D-arm-linker)chr12:124939711rs1042446343T / CNoNouniversal base change
9 (Acceptor-D-arm-linker)chr12:124939710rs970133733A / TNoNosubstitution in loop
9 (Acceptor-D-arm-linker)chr12:124939710rs970133733A / GNoNosubstitution in loop
10 (5′ D-arm)chr12:124939709rs912804211G / ANoNorestore Watson-Crick base pair
11 (5′ D-arm)chr12:124939708rs987038602T / CNoNobase pair mismatch
12 (5′ D-arm)chr12:124939707rs932920636A / GNoNoGU base pair
13 (5′ D-arm)chr12:124939706rs921401657T / GNoNobase pair mismatch
13 (5′ D-arm)chr12:124939706rs921401657T / CNoNorestore Watson-Crick base pair
14 (D-loop)chr12:124939705rs974274476A / GNoNouniversal base change
15 (D-loop)chr12:124939704rs963077102G / ANoNosubstitution in loop
18 (D-loop)chr12:124939702rs1015716528G / ANoNouniversal base change
19 (D-loop)chr12:124939701rs982772517G / TNoNouniversal base change
20a (D-loop)chr12:124939699rs867313176G / CNoNosubstitution in loop
21 (D-loop)chr12:124939698rs1024879170A / GNoNouniversal base change
21 (D-loop)chr12:124939698rs1024879170A / CNoNouniversal base change
22 (3′ D-arm)chr12:124939697rs1013480398G / ANoNorestore Watson-Crick base pair
24 (3′ D-arm)chr12:124939695rs959284731A / CNoNobase pair mismatch
25 (3′ D-arm)chr12:124939694rs1023008847T / GNoNobase pair mismatch
25 (3′ D-arm)chr12:124939694rs1023008847T / CNoNorestore Watson-Crick base pair
26 (D-arm-Anticodon-linker)chr12:124939693rs1033891937C / TNoNosubstitution in loop
26 (D-arm-Anticodon-linker)chr12:124939693rs1033891937C / ANoNosubstitution in loop
28 (5′ Anticodon Stem)chr12:124939691rs566048932C / TNoYesGU base pair
29 (5′ Anticodon Stem)chr12:124939690rs34107532- / CNoNorepair bulge
29 (5′ Anticodon Stem)chr12:124939690rs963191157C / TNoNoGU base pair
30 (5′ Anticodon Stem)chr12:124939689rs368766083G / ANoYesbase pair mismatch
31 (5′ Anticodon Stem)chr12:124939688rs529325368C / TNoYesGU base pair
32 (Anticodon Loop)chr12:124939687rs561130012C / TNoYessubstitution in loop
33 (Anticodon Loop)chr12:124939686rs1009171345T / CNoNouniversal base change
34 (Anticodon Loop)chr12:124939685rs890766012G / ANoNosynonymous anticodon change
38 (Anticodon Loop)chr12:124939681rs570637074C / TNoYessubstitution in loop
40 (3′ Anticodon Stem)chr12:124939679rs1029925753C / GNoNobase pair mismatch
42 (3′ Anticodon Stem)chr12:124939677rs530857085G / ANoYesbase pair mismatch
43 (3′ Anticodon Stem)chr12:124939676rs997143580- / TNoNorepair bulge
43 (3′ Anticodon Stem)chr12:124939676rs932869644G / ANoNobase pair mismatch
44 (Variable Loop)chr12:124939675rs921527009A / GNoNosubstitution in loop
45 (Variable Loop)chr12:124939674rs1038939590G / ANoNosubstitution in loop
46 (Variable Loop)chr12:124939673rs941571479A / GNoNosubstitution in loop
48 (Variable Loop)chr12:124939672rs908606805C / TNoNosubstitution in loop
48 (Variable Loop)chr12:124939672rs908606805C / GNoNosubstitution in loop
49 (5′ T-arm)chr12:124939671rs563498505C / TNoYesGU base pair
49 (5′ T-arm)chr12:124939671rs563498505C / GNoYesbase pair mismatch
49 (5′ T-arm)chr12:124939671rs563498505C / ANoYesbase pair mismatch
50 (5′ T-arm)chr12:124939670rs971484706G / ANoNobase pair mismatch
51 (5′ T-arm)chr12:124939669rs150783197G / TNoYesbase pair mismatch
51 (5′ T-arm)chr12:124939669rs150783197G / ANoYesbase pair mismatch
52 (5′ T-arm)chr12:124939668rs917793707G / ANoNobase pair mismatch
53 (5′ T-arm)chr12:124939667rs551143660G / ANoNobase pair mismatch
54 (T-Psi-C Loop)chr12:124939666rs534545398T / ANoNouniversal base change
56 (T-Psi-C Loop)chr12:124939664rs868525348C / TNoNouniversal base change
57 (T-Psi-C Loop)chr12:124939663rs962867972- / TNoNosubstitution in loop
57 (T-Psi-C Loop)chr12:124939663rs962867972- / GNoNosubstitution in loop
57 (T-Psi-C Loop)chr12:124939663rs995611444G / CNoNosubstitution in loop
58 (T-Psi-C Loop)chr12:124939662rs1033637936A / GNoNouniversal base change
60 (T-Psi-C Loop)chr12:124939660rs985591469T / CNoNosubstitution in loop
61 (3′ T-arm)chr12:124939659rs1001096084C / TNoNoGU base pair
61 (3′ T-arm)chr12:124939659rs1001096084C / GNoNobase pair mismatch
61 (3′ T-arm)chr12:124939659rs1001096084C / ANoNobase pair mismatch
62 (3′ T-arm)chr12:124939658rs956560353C / TNoNoGU base pair
64 (3′ T-arm)chr12:124939656rs374755313C / TNoNoGU base pair
66 (3′ Acceptor Stem)chr12:124939654rs967933080A / GNoNoGU base pair
67 (3′ Acceptor Stem)chr12:124939653rs565543592C / TNoNoGU base pair
68 (3′ Acceptor Stem)chr12:124939652rs751714628G / ANoNobase pair mismatch
69 (3′ Acceptor Stem)chr12:124939651rs763785696- / TNoNorepair bulge
70 (3′ Acceptor Stem)chr12:124939650rs577629187G / ANoYesbase pair mismatch
71 (3′ Acceptor Stem)chr12:124939649rs1050679165G / CNoNobase pair mismatch
71 (3′ Acceptor Stem)chr12:124939649rs1050679165G / ANoNobase pair mismatch
73 (3′ end)chr12:124939647rs559187723G / ANoYessubstitution in loop