Gene: tRNA-Asp-GTC-2-11

Overview
Organism Homo sapiens
Locus chr17:8222238-8222309 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Asp-GTC-2-11
HGNC Symbol TRD-GTC2-11
RNAcentral ID URS00006174C2_9606
tRNAscan-SE ID chr17.trna36
GtRNAdb 2009
Legacy Name and Score
chr17.trna38-AspGTC (72.92 bits)
Predicted tRNA Isotype / Anticodon Asp GTC
Top Scoring / Second Best Scoring Isotype Model Asp (109.9 bits) / Gly (76.5 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 10
Upstream / Downstream Sequence GAAAGGTCTCTACAGGTCCC / AGTACTAGCAGTTTTGAAAC
Intron None
Possible Pseudogene No
Gene Score 66.5
Mature tRNA Score 66.5
HMM Score 35.70
Secondary Structure Score 30.80
Atypical Features None
Sequence
Genomic Sequence
TCCTCGTTAGTATAGTGGTgAGTATCCCCGCCTGTCACGCGGGAGaCCGGGGTTCGATTCCCCGACGGGGAG
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
UCCUCGUUAGUAUAGUGGUGAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGACGGGGAG
Alignments
Asp tRNAs
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<<<<<<<<. TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-1 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-10 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-11 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-2 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-3 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-4 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-5 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-6 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-7 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-8 Sc: 66.5 TCCTCGTTAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-2-9 Sc: 66.5 TCCTCGTTAGTATAGTGGTtA.GTATCCCCGCCTGTCACGCGGGAG...........ACCGGGGTTCAATTCCCCGACGGGGAG tRNA-Asp-GTC-1-1 Sc: 65.4 TCCTCGTTAGTATAGTGGTgA.GTGTCCCCGTCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCGACGGGGAG tRNA-Asp-GTC-3-1 Sc: 58.2
>>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>>>.......<<<<..<<<<<<<. TCCTCGTTAGTATGGTGGTgA.GTATCCCTGCCTGTCACGCGGGAG...........ACCGGGGTTCGATTCCCCA.ACGGGGAG tRNA-Asp-GTC-4-1 Sc: 47.6 (filtered) best isotype model: Asp Sc: 92.3 >>>>>.>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>>>.......<<<<<.<.<<<<<. TCCTCATCAGTATAGTGGTgA.GTATCCCCGCCTGTCACGCGGGAG...........ACTGGGGTTCGATTCCCTG.AGGAGGAG tRNA-Asp-GTC-5-1 Sc: 40.3 (filtered) best isotype model: Asp Sc: 82.2 >>>>>>>..>>>>.........<<<<.>>>.>.......<.<<<...............>>>>>.......<<<<<.<<<<<<<. TTCTTGTTAATATAGTGGTgA.GTATTCCCACCTGTCATGCGGGA............GACGGGGTTCAATTCCCTG.ATGGGGAG tRNA-Asp-GTC-6-1 Sc: 38.2 (filtered) best isotype model: Asp Sc: 68.8 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTgA.GTATCTCTGCCTGTCATGCGTGAG...........AGAGGGGGTCGATTCCCCG.ACGGGGAG tRNA-Asp-GTC-10-1 Sc: 23.5 (filtered) best isotype model: Asp Sc: 57.0 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<...............>>>.>.......<.<<<.<<<<<<<. TCCTTGTTAGTATAGTGGTgA.GTGTTTCTGCCTGTCATGTGGAG............ACTGGAGTTTGAGTCCCCA.ACAGGGAG tRNA-Asp-GTC-8-1 Sc: 30.3 (filtered) best isotype model: Asp Sc: 53.6 >>>>>>>...>>>.........<<<..>.>>>.......<<<.<................>>>>.......<<<<..<<<<<<<. TCCTTGTTACTATAGTGGTaA.GTATCTCTGCCTGTCATGCATGAG...........AGAGGGGGTCGATTCCCTG.ACGGGGAG tRNA-Asp-GTC-9-1 Sc: 24.8 (filtered) best isotype model: Asp Sc: 53.0
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
45.145.021.3109.926.650.463.876.563.525.6No Hit13.045.2No Hit43.5-16.3No Hit56.037.926.940.5No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (56)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr17:8222309rs778653626T / ANoNobase pair mismatch
3 (5′ Acceptor Stem)chr17:8222307rs988281034C / GNoNobase pair mismatch
6 (5′ Acceptor Stem)chr17:8222304rs957760575G / CNoNobase pair mismatch
10 (5′ D-arm)chr17:8222300rs1032073403G / TNoNobase pair mismatch
11 (5′ D-arm)chr17:8222299rs1001862962T / CNoNobase pair mismatch
12 (5′ D-arm)chr17:8222298rs969492187A / GNoNoGU base pair
13 (5′ D-arm)chr17:8222297rs151191687T / CNoYesrestore Watson-Crick base pair
14 (D-loop)chr17:8222296rs1024646659A / GNoNouniversal base change
20 (D-loop)chr17:8222291rs539660985T / GNoYessubstitution in loop
21 (D-loop)chr17:8222289rs1016930389A / CNoNouniversal base change
25 (3′ D-arm)chr17:8222285rs950495079T / CNoNorestore Watson-Crick base pair
26 (D-arm-Anticodon-linker)chr17:8222284rs1006365457C / TNoNosubstitution in loop
27 (5′ Anticodon Stem)chr17:8222283rs188670824C / TNoYesGU base pair
28 (5′ Anticodon Stem)chr17:8222282rs897760819C / TNoNoGU base pair
29 (5′ Anticodon Stem)chr17:8222281rs551260346C / TNoYesGU base pair
29 (5′ Anticodon Stem)chr17:8222281rs551260346C / ANoYesbase pair mismatch
30 (5′ Anticodon Stem)chr17:8222280rs567506473G / ANoNobase pair mismatch
32 (Anticodon Loop)chr17:8222278rs371634113C / TNoNosubstitution in loop
33 (Anticodon Loop)chr17:8222277rs1036176823T / CNoNouniversal base change
37 (Anticodon Loop)chr17:8222273rs1006082005A / GNoNosubstitution in loop
38 (Anticodon Loop)chr17:8222272rs901837407C / TNoNosubstitution in loop
39 (3′ Anticodon Stem)chr17:8222271rs184031241G / CNoYesbase pair mismatch
40 (3′ Anticodon Stem)chr17:8222270rs1041707640C / TNoNoGU base pair
41 (3′ Anticodon Stem)chr17:8222269rs1010246233G / ANoNobase pair mismatch
42 (3′ Anticodon Stem)chr17:8222268rs893032994G / ANoNobase pair mismatch
43 (3′ Anticodon Stem)chr17:8222267rs1048993274G / TNoNobase pair mismatch
44 (Variable Loop)chr17:8222266rs932667419A / GNoNosubstitution in loop
45 (Variable Loop)chr17:8222265rs549480501G / CNoNosubstitution in loop
46 (Variable Loop)chr17:8222264rs921223460A / GNoNosubstitution in loop
48 (Variable Loop)chr17:8222263rs1041058016C / TNoNosubstitution in loop
48 (Variable Loop)chr17:8222263rs1041058016C / GNoNosubstitution in loop
49 (5′ T-arm)chr17:8222262rs944256085C / TNoNoGU base pair
51 (5′ T-arm)chr17:8222260rs949836176G / CNoNobase pair mismatch
52 (5′ T-arm)chr17:8222259rs914171131G / TNoNobase pair mismatch
52 (5′ T-arm)chr17:8222259rs914171131G / ANoNobase pair mismatch
53 (5′ T-arm)chr17:8222258rs988250245G / ANoNobase pair mismatch
56 (T-Psi-C Loop)chr17:8222255rs751853010C / TNoNouniversal base change
56 (T-Psi-C Loop)chr17:8222255rs751853010C / GNoNouniversal base change
57 (T-Psi-C Loop)chr17:8222254rs962371871G / CNoNosubstitution in loop
59 (T-Psi-C Loop)chr17:8222252rs562155653T / CNoYessubstitution in loop
61 (3′ T-arm)chr17:8222250rs377707620C / ANoNobase pair mismatch
62 (3′ T-arm)chr17:8222249rs925025194C / TNoNoGU base pair
63 (3′ T-arm)chr17:8222248rs191963259C / TNoYesGU base pair
63 (3′ T-arm)chr17:8222248rs191963259C / GNoYesbase pair mismatch
64 (3′ T-arm)chr17:8222247rs980967492C / TNoNoGU base pair
65 (3′ T-arm)chr17:8222246rs759224821- / TNoNorepair bulge
65 (3′ T-arm)chr17:8222246rs528616855G / ANoYesbase pair mismatch
67 (3′ Acceptor Stem)chr17:8222244rs187366476C / TNoYesGU base pair
67 (3′ Acceptor Stem)chr17:8222244rs187366476C / GNoYesbase pair mismatch
68 (3′ Acceptor Stem)chr17:8222243rs1025033118G / TNoNobase pair mismatch
69 (3′ Acceptor Stem)chr17:8222242rs374239138G / TNoNobase pair mismatch
69 (3′ Acceptor Stem)chr17:8222242rs374239138G / ANoNorestore Watson-Crick base pair
70 (3′ Acceptor Stem)chr17:8222241rs546288752G / CNoYesbase pair mismatch
70 (3′ Acceptor Stem)chr17:8222241rs546288752G / ANoYesbase pair mismatch
72 (3′ Acceptor Stem)chr17:8222239rs1014881175A / GNoNoGU base pair
73 (3′ end)chr17:8222238rs1006052617G / ANoNosubstitution in loop