Gene: tRNA-Met-CAT-4-3

Overview
Organism Homo sapiens
Locus chr6:26766234-26766306 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Met-CAT-4-3
HGNC Symbol TRM-CAT4-3
RNAcentral ID URS0000703910_9606
tRNAscan-SE ID chr6.trna28
GtRNAdb 2009
Legacy Name and Score
chr6.trna27-MetCAT (75.76 bits)
Predicted tRNA Isotype / Anticodon Met CAT
Top Scoring / Second Best Scoring Isotype Model Met (108.2 bits) / Thr (83.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 4 out of 7
Upstream / Downstream Sequence GCGCGTTGATGCACTTCGTC / GCTTTTGCAAGTGAACGCTT
Intron None
Possible Pseudogene No
Gene Score 80.2
Mature tRNA Score 80.2
HMM Score 56.30
Secondary Structure Score 23.90
Atypical Features U31:U39
Sequence
Genomic Sequence
GCCCTCTTAGCGCAGCGGGcAGCGCGTCAGTCTCATAATCTGAAGGtCCTGAGTTCGAGCCTCAGAGAGGGCA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>.........<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCCCUCUUAGCGCAGCGGGCAGCGCGUCAGUCUCAUAAUCUGAAGGUCCUGAGUUCGAGCCUCAGAGAGGGCA
Alignments
Met tRNAs
>>>>>>>..>>>>..........<<<<.>>>>.........<<<<................>>>>>.......<<<<<<<<<<<<.... GCCCTCTTAGCGCAGT.GGGcA.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCGAGCCTCAGAGAGGGCA... tRNA-Met-CAT-2-1 Sc: 82.7 GCCTCGTTAGCGCAGTAGGT.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCGTGAGTTCGATCCTCACACGGGGCA... tRNA-Met-CAT-1-1 Sc: 82.3 GCCCTCTTAGCGCAGC.GGGcA.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCGAGCCTCAGAGAGGGCA... tRNA-Met-CAT-4-1 Sc: 80.2 GCCCTCTTAGCGCAGC.GGGcA.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCGAGCCTCAGAGAGGGCA... tRNA-Met-CAT-4-2 Sc: 80.2 GCCCTCTTAGCGCAGC.GGGcA.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCGAGCCTCAGAGAGGGCA... tRNA-Met-CAT-4-3 Sc: 80.2 GCCCTCTTAGCGCAGCTGGC.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCAAGCCTCAGAGAGGGCA... tRNA-Met-CAT-5-1 Sc: 79.2 GCCCTCTTAGCGCAGCTGGC.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCAAGCCTCAGAGAGGGCA... tRNA-Met-CAT-5-2 Sc: 79.2 GCCTCCTTAGCGCAGTAGGC.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCGAACCTCAGAGGGGGCA... tRNA-Met-CAT-3-1 Sc: 77.4 GCCTCCTTAGCGCAGTAGGC.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAGTTCGAACCTCAGAGGGGGCA... tRNA-Met-CAT-3-2 Sc: 77.4 GCCTCGTTAGCGCAGTAGGC.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCGTGAGTTCGAGCCTCACACGGGGCA... tRNA-Met-CAT-6-1 Sc: 77.4 GCCCTCTTAGTGCAGCTGGC.A.GCGCGTCAGTTTCATAATCTGAAA...........GtCCTGAGTTCAAGCCTCAGAGAGGGCA... tRNA-Met-CAT-7-1 Sc: 66.2 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... AGCAGAGTGGCGCAGC.GGA.A.GCGTGCTGGGCCCATAACCCAGAG...........GtCGATGGATCGAAACCATCCTCTGCTA... DM9990_CAT_HUMAN_CY AGCAGAGTGGCGCAGC.GGA.A.GCGTGCTGGGCCCATAACCCAGAG...........GtCGATGGATCGAAACCATCCTCTGCTA... DX9990_CAT_HUMAN_CY AGCAGAGTGGCGCAGC.GGA.A.GCGTGCTGGGCCCATAACCCAGAG...........GtCGATGGATCTAAACCATCCTCTGCTA... DX9991_CAT_HUMAN_CY >>>>>>>..>>>>..........<<<<.>>>>.........<<<<................>>>>>.......<<<<<<<<<<<<.... GCCTCGTTAGCGCAGTAGGT.A.GCGCGTCAGTCTCATAATCTGAAG...........GtCGTGAGTTCGATCCTCACACGGGGCAcca RM9990_CAT_HUMAN_HELA-CELLS >>>>>>>..>>>>..........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... AGCAGAGTGGCGCAGC.GGA.A.GCGTGCTGGGCCCATAACCCAGAG...........GtCGATGGATCGAAACCATCCTCTGCTAcca RX9990_CAT_HUMAN_PLACENTA
>>>>>.>..>>>>...........<<<<.>>>>.........<<<<................>>.>.>............<<.<<......<.<<<<<. GTCTTCTTAGCGCAGT.GAGcA..GCGCGTCAGTCTCATAATCTGAAG...........GtCCTGAtGTTCGAGC.....CTGAG......AAAAGGCA tRX-Met-NNN-2-1 Sc: 41.7 (filtered) best isotype model: Met Sc: 67.9 >>>>>>>..>..>...........<..<.>>>>.........<<<<................>.>>.>............<<<.<......<<<<<<<. GCCTTCTTAGCCCTGGAGGC.A..GCACATCAGTCTCATAATCTGAAG...........GtCCCGA.GCTTGAAC.....CTCAG......AGAGGGCA tRX-Met-NNN-1-1 Sc: 24.1 (filtered) best isotype model: Met Sc: 47.7 >>>>>>>..>>>>...........<<<<.>>.>.........<.<<................>>>>.>............<<<<<......<<<<<<<. GCAGCTGTGGCTCAGT.GGAaA..GAGCATCAGTCTGGGTATCAGAAG...........A.CCTAG.GT...........CCTAGccc...CAGCTGTA tRX-Pro-NNN-1-1 Sc: 24.8 (filtered) best isotype model: Met Sc: 25.7 >>>.>>>...>>>...........<<<...>>>>.......<<<<.................>>>>.>............<<<<<......<<<.<<<. GTGGATA..GCCCAGC.GGCtAt.GGGAGCCGGGCTCTCACTCTGAC............GtCCTGG.GTTCAAGT.....CCCAG......TGTGCACA tRNA-Glu-CTC-16-1 Sc: 27.3 (filtered) best isotype model: Met Sc: 6.8
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
42.769.364.541.252.647.330.838.450.778.319.779.4108.265.729.7No Hit14.783.452.433.575.0-9.1
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (1)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
53 (5′ T-arm)chr6:26766286rs200791909- / TNoNorepair bulge