Gene: tRNA-Phe-GAA-1-1

Overview
Organism Homo sapiens
Locus chr6:28790722-28790794 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Phe-GAA-1-1
HGNC Symbol TRF-GAA1-1
RNAcentral ID URS000029CCC5_9606
tRNAscan-SE ID chr6.trna117
GtRNAdb 2009
Legacy Name and Score
chr6.trna109-PheGAA (84.19 bits)
Predicted tRNA Isotype / Anticodon Phe GAA
Top Scoring / Second Best Scoring Isotype Model Phe (124.5 bits) / Tyr (83.7 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 12
Upstream / Downstream Sequence TAAAACAACAAATTCGGGAA / GGGTTTTTTTTTTTTCTTTC
Intron None
Possible Pseudogene No
Gene Score 88.9
Mature tRNA Score 88.9
HMM Score 68.40
Secondary Structure Score 20.50
Atypical Features None
Known Modifications (Modomics) m2G10 m1A14 D16 D17 m2,2G26 Ψ27 Ψ28 Cm32 Gm34 o2yW37 Ψ39 m7G46 D47 m5C49 m5U54 Ψ55 m1A58
Sequence
Genomic Sequence
GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAAGGtCCCTGGTTCGATCCCGGGTTTCGGCA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCA
Alignments
Phe tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-1 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-2 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-3 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-4 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-5 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-6 Sc: 88.9 GCCGAGATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-3-1 Sc: 88.3 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-2-1 Sc: 87.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACCGAAGATCTtAAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-4-1 Sc: 75.5 >>>>>>>..>>>>........<<<<.>.>>>.......<<<..<.................>>>>>.......<<<<<<<<<<<<.... GCTGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.TAAA...........GttCCCTGGTTCAACCCTGGGTTTCAGCC... tRNA-Phe-GAA-6-1 Sc: 58.8 >>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCAcca RF9990_GAA_HUMAN_PLACENTA
>>>.>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<.....<<<.... GCCAAAATTGCTCAGTTGGGAGAGCGTTAGACTGAAG...ATCTAAAG...........GtCCCTGGTTCGATCCCGGGTTTCaccaGGTT... tRNA-Phe-GAA-5-1 Sc: 65.8 (filtered) best isotype model: Phe Sc: 102.9 .>..>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<......<..... GCCAAAATAGCTCAGCTGGGAGAGCATTAGACTGAAG...ATCTAAAG...........GtCTCTGGTTTGATCCTGGGTTTC....AGAA... tRNA-Phe-GAA-8-1 Sc: 45.5 (filtered) best isotype model: Phe Sc: 86.7 >.>>>>>..>>>>........<<<<..>>>>..........<<<<.................>>>>>.......<<<<<<<<<....<.<.... GCCGAAATAGCTCAATTGGGAGAGTGTTAGACTGAAGatcTTCTGCAG...........GtCTCTGGTTCAATTCCGGGTTTC....GACA... tRNA-Phe-GAA-7-1 Sc: 50.0 (filtered) best isotype model: Phe Sc: 78.5 >>>>>>>..>>>>........<<<<.>.>>............<<.<.................>>>>.......<<<<.<<<<....<<<.... GCTGAGATAGCTCGGTTGGGAGGGCATCAGCCTGAAG...ATCTAAAG...........GaGACTGGTTCAATTCTGGGTTTT....GGCA... tRNA-Phe-GAA-11-1 Sc: 33.3 (filtered) best isotype model: Phe Sc: 41.1 .>>.>>>..>>>>........<<<<.>>..>..........<..<<................>>>.>.......<.<<<<<<.....<<..... GCCAAAATAGCTCAGCTGGGAGAGTATTAGGTTGAAG...ATACAAAG...........TtCCTTGGCTCAATCCAGAGTTTG....GGGGact tRNA-Phe-GAA-12-1 Sc: 22.4 (filtered) best isotype model: Phe Sc: 29.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
60.661.548.837.481.329.222.436.455.265.511.975.576.2124.539.5No Hit8.979.765.183.752.99.6
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-24.7No HitNo HitNo Hit38.5No HitNo HitNo HitNo HitNo Hit-13.8No Hit

Top score2nd highest score3rd highest score
DNA Variants (53)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr6:28790794rs188567543G / CNoYesbase pair mismatch
2 (5′ Acceptor Stem)chr6:28790793rs1000718410C / TNoNoGU base pair
3 (5′ Acceptor Stem)chr6:28790792rs184167233C / TNoYesGU base pair
5 (5′ Acceptor Stem)chr6:28790790rs750800884A / CNoNobase pair mismatch
6 (5′ Acceptor Stem)chr6:28790789rs1044401598A / GNoNoGU base pair
8 (Acceptor-D-arm-linker)chr6:28790787rs1045178670T / ANoNouniversal base change
9 (Acceptor-D-arm-linker)chr6:28790786rs191630498A / GNoYessubstitution in loop
11 (5′ D-arm)chr6:28790784rs896477708C / TNoNoGU base pair
11 (5′ D-arm)chr6:28790784rs896477708C / GNoNobase pair mismatch
11 (5′ D-arm)chr6:28790784rs896477708C / ANoNobase pair mismatch
13 (5′ D-arm)chr6:28790782rs1047094655C / TNoNoGU base pair
17 (D-loop)chr6:28790778rs930209925T / GNoNosubstitution in loop
21 (D-loop)chr6:28790774rs920215998A / CNoNouniversal base change
23 (3′ D-arm)chr6:28790772rs779227934A / GNoNoGU base pair
24 (3′ D-arm)chr6:28790771rs929436918G / ANoNobase pair mismatch
25 (3′ D-arm)chr6:28790770rs919439472C / TNoNoGU base pair
28 (5′ Anticodon Stem)chr6:28790767rs187482209T / GNoYesbase pair mismatch
28 (5′ Anticodon Stem)chr6:28790767rs187482209T / CNoYesbase pair mismatch
29 (5′ Anticodon Stem)chr6:28790766rs185189413A / GNoYesGU base pair
31 (5′ Anticodon Stem)chr6:28790764rs910326749A / GNoNoGU base pair
32 (Anticodon Loop)chr6:28790763rs942885722C / TNoNosubstitution in loop
32 (Anticodon Loop)chr6:28790763rs942885722C / GNoNosubstitution in loop
34 (Anticodon Loop)chr6:28790761rs193119604G / ANoYessynonymous anticodon change
42 (3′ Anticodon Stem)chr6:28790753rs138673963A / GNoYesGU base pair
46 (Variable Loop)chr6:28790749rs143116994G / TNoYessubstitution in loop
46 (Variable Loop)chr6:28790749rs143116994G / ANoYessubstitution in loop
48 (Variable Loop)chr6:28790747rs954518574C / ANoNosubstitution in loop
49 (5′ T-arm)chr6:28790746rs752291316C / TNoNoGU base pair
49 (5′ T-arm)chr6:28790746rs752291316C / GNoNobase pair mismatch
49 (5′ T-arm)chr6:28790746rs752291316C / ANoNobase pair mismatch
50 (5′ T-arm)chr6:28790745rs763082683- / CNoNorepair bulge
51 (5′ T-arm)chr6:28790744rs188914051T / CNoYesrestore Watson-Crick base pair
51 (5′ T-arm)chr6:28790744rs188914051T / ANoYesbase pair mismatch
52 (5′ T-arm)chr6:28790743rs1003827827G / CNoNobase pair mismatch
53 (5′ T-arm)chr6:28790742rs987848275G / TNoNobase pair mismatch
53 (5′ T-arm)chr6:28790742rs987848275G / ANoNobase pair mismatch
54 (T-Psi-C Loop)chr6:28790741rs956810613T / CNoNouniversal base change
56 (T-Psi-C Loop)chr6:28790739rs1032270957C / GNoNouniversal base change
57 (T-Psi-C Loop)chr6:28790738rs182608898G / ANoYessubstitution in loop
59 (T-Psi-C Loop)chr6:28790736rs887797596T / CNoNosubstitution in loop
60 (T-Psi-C Loop)chr6:28790735rs905028232C / TNoNosubstitution in loop
61 (3′ T-arm)chr6:28790734rs929546574C / TNoNoGU base pair
62 (3′ T-arm)chr6:28790733rs367853648C / TNoYesGU base pair
64 (3′ T-arm)chr6:28790731rs1040555875G / ANoNobase pair mismatch
65 (3′ T-arm)chr6:28790730rs557352590G / CNoNobase pair mismatch
65 (3′ T-arm)chr6:28790730rs557352590G / ANoNobase pair mismatch
68 (3′ Acceptor Stem)chr6:28790727rs559996377T / CNoYesbase pair mismatch
69 (3′ Acceptor Stem)chr6:28790726rs546226901C / TNoYesGU base pair
69 (3′ Acceptor Stem)chr6:28790726rs546226901C / GNoYesbase pair mismatch
70 (3′ Acceptor Stem)chr6:28790725rs149064233G / ANoYesbase pair mismatch
71 (3′ Acceptor Stem)chr6:28790724rs898714248G / ANoNobase pair mismatch
72 (3′ Acceptor Stem)chr6:28790723rs372802032C / TNoYesGU base pair
73 (3′ end)chr6:28790722rs543929506A / GNoYessubstitution in loop