Gene: tRNA-Phe-GAA-1-2

Overview
Organism Homo sapiens
Locus chr6:28981672-28981744 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Phe-GAA-1-2
HGNC Symbol TRF-GAA1-2
RNAcentral ID URS000029CCC5_9606
tRNAscan-SE ID chr6.trna103
GtRNAdb 2009
Legacy Name and Score
chr6.trna96-PheGAA (84.19 bits)
Predicted tRNA Isotype / Anticodon Phe GAA
Top Scoring / Second Best Scoring Isotype Model Phe (124.5 bits) / Tyr (83.7 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 12
Upstream / Downstream Sequence TTTTAAGTGGCGTGGGCGGA / TGAGAGCGCTCGGTTTTTTG
Intron None
Possible Pseudogene No
Gene Score 88.9
Mature tRNA Score 88.9
HMM Score 68.40
Secondary Structure Score 20.50
Atypical Features None
Known Modifications (Modomics) m2G10 m1A14 D16 D17 m2,2G26 Ψ27 Ψ28 Cm32 Gm34 o2yW37 Ψ39 m7G46 D47 m5C49 m5U54 Ψ55 m1A58
Sequence
Genomic Sequence
GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAAGGtCCCTGGTTCGATCCCGGGTTTCGGCA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCA
Alignments
Phe tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-1 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-2 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-3 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-4 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-5 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-6 Sc: 88.9 GCCGAGATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-3-1 Sc: 88.3 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-2-1 Sc: 87.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACCGAAGATCTtAAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-4-1 Sc: 75.5 >>>>>>>..>>>>........<<<<.>.>>>.......<<<..<.................>>>>>.......<<<<<<<<<<<<.... GCTGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.TAAA...........GttCCCTGGTTCAACCCTGGGTTTCAGCC... tRNA-Phe-GAA-6-1 Sc: 58.8 >>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCAcca RF9990_GAA_HUMAN_PLACENTA
>>>.>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<.....<<<.... GCCAAAATTGCTCAGTTGGGAGAGCGTTAGACTGAAG...ATCTAAAG...........GtCCCTGGTTCGATCCCGGGTTTCaccaGGTT... tRNA-Phe-GAA-5-1 Sc: 65.8 (filtered) best isotype model: Phe Sc: 102.9 .>..>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<......<..... GCCAAAATAGCTCAGCTGGGAGAGCATTAGACTGAAG...ATCTAAAG...........GtCTCTGGTTTGATCCTGGGTTTC....AGAA... tRNA-Phe-GAA-8-1 Sc: 45.5 (filtered) best isotype model: Phe Sc: 86.7 >.>>>>>..>>>>........<<<<..>>>>..........<<<<.................>>>>>.......<<<<<<<<<....<.<.... GCCGAAATAGCTCAATTGGGAGAGTGTTAGACTGAAGatcTTCTGCAG...........GtCTCTGGTTCAATTCCGGGTTTC....GACA... tRNA-Phe-GAA-7-1 Sc: 50.0 (filtered) best isotype model: Phe Sc: 78.5 >>>>>>>..>>>>........<<<<.>.>>............<<.<.................>>>>.......<<<<.<<<<....<<<.... GCTGAGATAGCTCGGTTGGGAGGGCATCAGCCTGAAG...ATCTAAAG...........GaGACTGGTTCAATTCTGGGTTTT....GGCA... tRNA-Phe-GAA-11-1 Sc: 33.3 (filtered) best isotype model: Phe Sc: 41.1 .>>.>>>..>>>>........<<<<.>>..>..........<..<<................>>>.>.......<.<<<<<<.....<<..... GCCAAAATAGCTCAGCTGGGAGAGTATTAGGTTGAAG...ATACAAAG...........TtCCTTGGCTCAATCCAGAGTTTG....GGGGact tRNA-Phe-GAA-12-1 Sc: 22.4 (filtered) best isotype model: Phe Sc: 29.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
60.661.548.837.481.329.222.436.455.265.511.975.576.2124.539.5No Hit8.979.765.183.752.99.6
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-24.7No HitNo HitNo Hit38.5No HitNo HitNo HitNo HitNo Hit-13.8No Hit

Top score2nd highest score3rd highest score
DNA Variants (44)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
2 (5′ Acceptor Stem)chr6:28981743rs898515567C / TNoNoGU base pair
3 (5′ Acceptor Stem)chr6:28981742rs561477312C / TNoYesGU base pair
3 (5′ Acceptor Stem)chr6:28981742rs561477312C / GNoYesbase pair mismatch
4 (5′ Acceptor Stem)chr6:28981741rs544885608G / TNoYesbase pair mismatch
6 (5′ Acceptor Stem)chr6:28981739rs368168256A / CNoNobase pair mismatch
8 (Acceptor-D-arm-linker)chr6:28981737rs180807346T / GNoYesuniversal base change
8 (Acceptor-D-arm-linker)chr6:28981737rs180807346T / CNoYesuniversal base change
10 (5′ D-arm)chr6:28981735rs908697874G / ANoNobase pair mismatch
11 (5′ D-arm)chr6:28981734rs376016890C / TNoNoGU base pair
12 (5′ D-arm)chr6:28981733rs189309333T / CNoYesbase pair mismatch
14 (D-loop)chr6:28981731rs887565801A / GNoNouniversal base change
17 (D-loop)chr6:28981728rs975678338T / CNoNosubstitution in loop
21 (D-loop)chr6:28981724rs570175256- / TNoNouniversal base change
24 (3′ D-arm)chr6:28981721rs867649977G / CNoNobase pair mismatch
30 (5′ Anticodon Stem)chr6:28981715rs1048786480G / ANoNobase pair mismatch
37 (Anticodon Loop)chr6:28981708rs1032707325G / ANoNosubstitution in loop
38 (Anticodon Loop)chr6:28981707rs931831533A / CNoNosubstitution in loop
39 (3′ Anticodon Stem)chr6:28981706rs545108923T / ANoYesbase pair mismatch
40 (3′ Anticodon Stem)chr6:28981705rs921747792C / TNoNoGU base pair
41 (3′ Anticodon Stem)chr6:28981704rs1014009163- / TNoNorepair bulge
41 (3′ Anticodon Stem)chr6:28981704rs146362461T / GNoYesbase pair mismatch
42 (3′ Anticodon Stem)chr6:28981703rs751116754A / GNoNoGU base pair
43 (3′ Anticodon Stem)chr6:28981702rs553235974A / TNoYesbase pair mismatch
43 (3′ Anticodon Stem)chr6:28981702rs553235974A / GNoYesGU base pair
45 (Variable Loop)chr6:28981700rs543108156G / CNoYessubstitution in loop
46 (Variable Loop)chr6:28981699rs556436812G / ANoYessubstitution in loop
48 (Variable Loop)chr6:28981697rs978158241C / GNoNosubstitution in loop
49 (5′ T-arm)chr6:28981696rs968023294C / TNoNoGU base pair
49 (5′ T-arm)chr6:28981696rs968023294C / ANoNobase pair mismatch
51 (5′ T-arm)chr6:28981694rs1022416847T / CNoNorestore Watson-Crick base pair
53 (5′ T-arm)chr6:28981692rs940016512G / CNoNobase pair mismatch
54 (T-Psi-C Loop)chr6:28981691rs887163811T / CNoNouniversal base change
56 (T-Psi-C Loop)chr6:28981689rs990873269C / TNoNouniversal base change
60 (T-Psi-C Loop)chr6:28981685rs1051192912C / TNoNosubstitution in loop
61 (3′ T-arm)chr6:28981684rs762332734C / TNoNoGU base pair
62 (3′ T-arm)chr6:28981683rs934122524C / GNoNobase pair mismatch
64 (3′ T-arm)chr6:28981681rs921454899G / TNoNobase pair mismatch
66 (3′ Acceptor Stem)chr6:28981679rs142105459T / CNoYesbase pair mismatch
67 (3′ Acceptor Stem)chr6:28981678rs936299782T / CNoNobase pair mismatch
68 (3′ Acceptor Stem)chr6:28981677rs925606436T / GNoNobase pair mismatch
69 (3′ Acceptor Stem)chr6:28981676rs769701901C / TNoNoGU base pair
70 (3′ Acceptor Stem)chr6:28981675rs537718142G / ANoYesbase pair mismatch
71 (3′ Acceptor Stem)chr6:28981674rs184846255G / ANoYesbase pair mismatch
73 (3′ end)chr6:28981672rs1004209105A / CNoNosubstitution in loop