Gene: tRNA-Phe-GAA-1-3

Overview
Organism Homo sapiens
Locus chr11:59557497-59557569 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Phe-GAA-1-3
HGNC Symbol TRF-GAA1-3
RNAcentral ID URS000029CCC5_9606
tRNAscan-SE ID chr11.trna15
GtRNAdb 2009
Legacy Name and Score
chr11.trna15-PheGAA (84.19 bits)
Predicted tRNA Isotype / Anticodon Phe GAA
Top Scoring / Second Best Scoring Isotype Model Phe (124.5 bits) / Tyr (83.7 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 1 out of 12
Upstream / Downstream Sequence CGGGACTGTCTCATGTCTTC / GACCTTTTGTTGGCTCAACC
Intron None
Possible Pseudogene No
Gene Score 88.9
Mature tRNA Score 88.9
HMM Score 68.40
Secondary Structure Score 20.50
Atypical Features None
Known Modifications (Modomics) m2G10 m1A14 D16 D17 m2,2G26 Ψ27 Ψ28 Cm32 Gm34 o2yW37 Ψ39 m7G46 D47 m5C49 m5U54 Ψ55 m1A58
Sequence
Genomic Sequence
GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCTAAAGGtCCCTGGTTCGATCCCGGGTTTCGGCA
Secondary Structure (nested bp)
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCGAUCCCGGGUUUCGGCA
Alignments
Phe tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-1 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-2 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-3 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-4 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-5 Sc: 88.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCA... tRNA-Phe-GAA-1-6 Sc: 88.9 GCCGAGATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-3-1 Sc: 88.3 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-2-1 Sc: 87.9 GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACCGAAGATCTtAAAG...........Gt.CCCTGGTTCAATCCCGGGTTTCGGCA... tRNA-Phe-GAA-4-1 Sc: 75.5 >>>>>>>..>>>>........<<<<.>.>>>.......<<<..<.................>>>>>.......<<<<<<<<<<<<.... GCTGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.TAAA...........GttCCCTGGTTCAACCCTGGGTTTCAGCC... tRNA-Phe-GAA-6-1 Sc: 58.8 >>>>>>>..>>>>........<<<<.>>>>>.......<<<.<<.................>>>>>.......<<<<<<<<<<<<.... GCCGAAATAGCTCAGTTGGGAGAGCGTTAGACTGAAGATCT.AAAG...........Gt.CCCTGGTTCGATCCCGGGTTTCGGCAcca RF9990_GAA_HUMAN_PLACENTA
>>>.>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<.....<<<.... GCCAAAATTGCTCAGTTGGGAGAGCGTTAGACTGAAG...ATCTAAAG...........GtCCCTGGTTCGATCCCGGGTTTCaccaGGTT... tRNA-Phe-GAA-5-1 Sc: 65.8 (filtered) best isotype model: Phe Sc: 102.9 .>..>>>..>>>>........<<<<.>>>>>..........<<<<<................>>>>>.......<<<<<<<<......<..... GCCAAAATAGCTCAGCTGGGAGAGCATTAGACTGAAG...ATCTAAAG...........GtCTCTGGTTTGATCCTGGGTTTC....AGAA... tRNA-Phe-GAA-8-1 Sc: 45.5 (filtered) best isotype model: Phe Sc: 86.7 >.>>>>>..>>>>........<<<<..>>>>..........<<<<.................>>>>>.......<<<<<<<<<....<.<.... GCCGAAATAGCTCAATTGGGAGAGTGTTAGACTGAAGatcTTCTGCAG...........GtCTCTGGTTCAATTCCGGGTTTC....GACA... tRNA-Phe-GAA-7-1 Sc: 50.0 (filtered) best isotype model: Phe Sc: 78.5 >>>>>>>..>>>>........<<<<.>.>>............<<.<.................>>>>.......<<<<.<<<<....<<<.... GCTGAGATAGCTCGGTTGGGAGGGCATCAGCCTGAAG...ATCTAAAG...........GaGACTGGTTCAATTCTGGGTTTT....GGCA... tRNA-Phe-GAA-11-1 Sc: 33.3 (filtered) best isotype model: Phe Sc: 41.1 .>>.>>>..>>>>........<<<<.>>..>..........<..<<................>>>.>.......<.<<<<<<.....<<..... GCCAAAATAGCTCAGCTGGGAGAGTATTAGGTTGAAG...ATACAAAG...........TtCCTTGGCTCAATCCAGAGTTTG....GGGGact tRNA-Phe-GAA-12-1 Sc: 22.4 (filtered) best isotype model: Phe Sc: 29.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
60.661.548.837.481.329.222.436.455.265.511.975.576.2124.539.5No Hit8.979.765.183.752.99.6
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-24.7No HitNo HitNo Hit38.5No HitNo HitNo HitNo HitNo Hit-13.8No Hit

Top score2nd highest score3rd highest score
DNA Variants (45)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr11:59557569rs76175201G / CYesYesbase pair mismatch
1 (5′ Acceptor Stem)chr11:59557569rs76175201G / AYesYesbase pair mismatch
2 (5′ Acceptor Stem)chr11:59557568rs990572745C / GNoNobase pair mismatch
3 (5′ Acceptor Stem)chr11:59557567rs562130098C / TNoNoGU base pair
4 (5′ Acceptor Stem)chr11:59557566rs535547918G / ANoYesbase pair mismatch
11 (5′ D-arm)chr11:59557559rs370288229C / TNoNoGU base pair
18 (D-loop)chr11:59557552rs1030903930G / ANoNouniversal base change
21 (D-loop)chr11:59557549rs966526543A / CNoNouniversal base change
22 (3′ D-arm)chr11:59557548rs748182342G / ANoNobase pair mismatch
24 (3′ D-arm)chr11:59557546rs778558900G / TNoNobase pair mismatch
25 (3′ D-arm)chr11:59557545rs868355568C / TNoNoGU base pair
27 (5′ Anticodon Stem)chr11:59557543rs1033287852T / ANoNobase pair mismatch
30 (5′ Anticodon Stem)chr11:59557540rs868064893G / ANoNobase pair mismatch
34 (Anticodon Loop)chr11:59557536rs970573546G / ANoNosynonymous anticodon change
37 (Anticodon Loop)chr11:59557533rs568123378G / ANoYessubstitution in loop
38 (Anticodon Loop)chr11:59557532rs1011965108A / TNoNosubstitution in loop
39 (3′ Anticodon Stem)chr11:59557531rs967511468T / CNoNobase pair mismatch
40 (3′ Anticodon Stem)chr11:59557530rs182532108C / TNoYesGU base pair
40 (3′ Anticodon Stem)chr11:59557530rs182532108C / ANoYesbase pair mismatch
41 (3′ Anticodon Stem)chr11:59557529rs750756765- / TNoNorepair bulge
41 (3′ Anticodon Stem)chr11:59557529rs995605939T / GNoNobase pair mismatch
42 (3′ Anticodon Stem)chr11:59557528rs1037323441A / GNoNoGU base pair
48 (Variable Loop)chr11:59557522rs781571678C / TNoNosubstitution in loop
49 (5′ T-arm)chr11:59557521rs895588371C / TNoNoGU base pair
49 (5′ T-arm)chr11:59557521rs895588371C / ANoNobase pair mismatch
50 (5′ T-arm)chr11:59557520rs1055451830C / TNoNoGU base pair
50 (5′ T-arm)chr11:59557520rs1055451830C / GNoNobase pair mismatch
51 (5′ T-arm)chr11:59557519rs534513089T / CNoYesrestore Watson-Crick base pair
52 (5′ T-arm)chr11:59557518rs888128951G / ANoNobase pair mismatch
55 (T-Psi-C Loop)chr11:59557515rs1049931386T / -NoNodeletion in loop
56 (T-Psi-C Loop)chr11:59557514rs768542734C / TNoNouniversal base change
57 (T-Psi-C Loop)chr11:59557513rs932726345GTCCCTGGTTCG / -NoNodeletion in loop
58 (T-Psi-C Loop)chr11:59557512rs749070499A / GNoNouniversal base change
60 (T-Psi-C Loop)chr11:59557510rs570751478C / TNoYessubstitution in loop
62 (3′ T-arm)chr11:59557508rs934690981C / -NoNobulge in stem
62 (3′ T-arm)chr11:59557508rs929901895C / TNoNoGU base pair
62 (3′ T-arm)chr11:59557508rs759147982TGGTTCGATCCC / -NoNobulge in stem
63 (3′ T-arm)chr11:59557507rs896951886G / CNoNobase pair mismatch
65 (3′ T-arm)chr11:59557505rs757870768G / ANoNobase pair mismatch
68 (3′ Acceptor Stem)chr11:59557502rs944802747T / CNoNobase pair mismatch
69 (3′ Acceptor Stem)chr11:59557501rs911994526C / TNoNoGU base pair
70 (3′ Acceptor Stem)chr11:59557500rs552171324G / ANoYesbase pair mismatch
72 (3′ Acceptor Stem)chr11:59557498rs1024735207C / TNoNoGU base pair
73 (3′ end)chr11:59557497rs530799466A / GNoYessubstitution in loop
73 (3′ end)chr11:59557497rs530799466A / CNoYessubstitution in loop