Gene: tRNA-Pro-AGG-2-2

Overview
Organism Homo sapiens
Locus chr6:26555270-26555341 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-AGG-2-2
HGNC Symbol TRP-AGG2-2
RNAcentral ID URS00005DB87D_9606
tRNAscan-SE ID chr6.trna12
GtRNAdb 2009
Legacy Name and Score
chr6.trna12-ProAGG (75.92 bits)
Predicted tRNA Isotype / Anticodon Pro AGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 4
Upstream / Downstream Sequence AAAATAATAAATGCTCAGGC / TAGTTTTGTCCCTTGCTTCT
Intron None
Possible Pseudogene No
Gene Score 70.2
Mature tRNA Score 70.2
HMM Score 43.80
Secondary Structure Score 26.40
Atypical Features None
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.139.8-8.853.450.951.850.961.958.627.419.0-3.628.04.8121.0No Hit4.756.750.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (56)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr6:26555270rs936986195G / ANoNobase pair mismatch
2 (5′ Acceptor Stem)chr6:26555271rs1054633296G / CNoNobase pair mismatch
3 (5′ Acceptor Stem)chr6:26555272rs931065877C / TNoNoGU base pair
5 (5′ Acceptor Stem)chr6:26555274rs777109313C / TNoNoGU base pair
10 (5′ D-arm)chr6:26555279rs984889136G / ANoNorestore Watson-Crick base pair
11 (5′ D-arm)chr6:26555280rs536417181T / CNoYesbase pair mismatch
12 (5′ D-arm)chr6:26555281rs750469427C / TNoNoGU base pair
13 (5′ D-arm)chr6:26555282rs1041893161T / GNoNoGU base pair
14 (D-loop)chr6:26555283rs891293070A / CNoNouniversal base change
14 (D-loop)chr6:26555283rs891293070A / GNoNouniversal base change
19 (D-loop)chr6:26555287rs796148241G / TNoNouniversal base change
20 (D-loop)chr6:26555288rs370973686T / CNoNosubstitution in loop
21 (D-loop)chr6:26555289rs1018494575A / GNoNouniversal base change
23 (3′ D-arm)chr6:26555291rs937336542G / ANoNobase pair mismatch
25 (3′ D-arm)chr6:26555293rs552906938T / GNoYesbase pair mismatch
27 (5′ Anticodon Stem)chr6:26555295rs893177812C / ANoNobase pair mismatch
29 (5′ Anticodon Stem)chr6:26555297rs1011682655C / TNoNoGU base pair
30 (5′ Anticodon Stem)chr6:26555298rs1020104265G / TNoNobase pair mismatch
32 (Anticodon Loop)chr6:26555300rs756283639T / CNoNosubstitution in loop
35 (Anticodon Loop)chr6:26555303rs902999012G / CNoNonon synonymous anticodon change
36 (Anticodon Loop)chr6:26555304rs995490928G / ANoNonon synonymous anticodon change
37 (Anticodon Loop)chr6:26555305rs1008092614G / TNoNosubstitution in loop
39 (3′ Anticodon Stem)chr6:26555307rs145114413G / ANoYesbase pair mismatch
40 (3′ Anticodon Stem)chr6:26555308rs148681556C / GNoYesbase pair mismatch
40 (3′ Anticodon Stem)chr6:26555308rs148681556C / TNoYesGU base pair
41 (3′ Anticodon Stem)chr6:26555309rs951465312G / ANoNobase pair mismatch
41 (3′ Anticodon Stem)chr6:26555309rs951465312G / CNoNobase pair mismatch
42 (3′ Anticodon Stem)chr6:26555310rs1026657765- / TNoNorepair bulge
43 (3′ Anticodon Stem)chr6:26555311rs564892515G / ANoYesbase pair mismatch
43 (3′ Anticodon Stem)chr6:26555311rs564892515G / CNoYesbase pair mismatch
45 (Variable Loop)chr6:26555313rs576949456G / ANoYessubstitution in loop
45 (Variable Loop)chr6:26555313rs576949456G / TNoYessubstitution in loop
46 (Variable Loop)chr6:26555314rs971184703G / ANoNosubstitution in loop
47 (Variable Loop)chr6:26555315rs771786302T / CNoNosubstitution in loop
48 (Variable Loop)chr6:26555316rs867768666C / GNoNosubstitution in loop
48 (Variable Loop)chr6:26555316rs867768666C / TNoNosubstitution in loop
49 (5′ T-arm)chr6:26555317rs779977797C / TNoNoGU base pair
50 (5′ T-arm)chr6:26555318rs937617363C / TNoNoGU base pair
51 (5′ T-arm)chr6:26555319rs927211997G / ANoNobase pair mismatch
51 (5′ T-arm)chr6:26555319rs927211997G / CNoNobase pair mismatch
52 (5′ T-arm)chr6:26555320rs543842360G / ANoYesbase pair mismatch
52 (5′ T-arm)chr6:26555320rs543842360G / CNoYesbase pair mismatch
53 (5′ T-arm)chr6:26555321rs947392503G / ANoNobase pair mismatch
59 (T-Psi-C Loop)chr6:26555327rs1041810560A / GNoNosubstitution in loop
61 (3′ T-arm)chr6:26555329rs937018641C / TNoNoGU base pair
62 (3′ T-arm)chr6:26555330rs754160858C / GNoNobase pair mismatch
62 (3′ T-arm)chr6:26555330rs754160858C / TNoNoGU base pair
63 (3′ T-arm)chr6:26555331rs554823817C / TNoYesGU base pair
64 (3′ T-arm)chr6:26555332rs1054158428G / ANoNobase pair mismatch
64 (3′ T-arm)chr6:26555332rs1054158428G / CNoNobase pair mismatch
67 (3′ Acceptor Stem)chr6:26555335rs746897127C / TNoNoGU base pair
68 (3′ Acceptor Stem)chr6:26555336rs575055165G / ANoYesbase pair mismatch
70 (3′ Acceptor Stem)chr6:26555338rs945839212G / ANoNobase pair mismatch
71 (3′ Acceptor Stem)chr6:26555339rs540789993C / TNoYesGU base pair
72 (3′ Acceptor Stem)chr6:26555340rs891301599C / ANoNobase pair mismatch
72 (3′ Acceptor Stem)chr6:26555340rs891301599C / TNoNoGU base pair