Gene: tRNA-Pro-AGG-2-3

Overview
Organism Homo sapiens
Locus chr7:128783450-128783521 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-AGG-2-3
HGNC Symbol TRP-AGG2-3
RNAcentral ID URS00005DB87D_9606
tRNAscan-SE ID chr7.trna4
GtRNAdb 2009
Legacy Name and Score
chr7.trna2-ProAGG (75.92 bits)
Predicted tRNA Isotype / Anticodon Pro AGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 2 out of 4
Upstream / Downstream Sequence GGCAAGAGATAACTACCAGT / TACTTTTTCTGTCCCTTCTC
Intron None
Possible Pseudogene No
Gene Score 70.2
Mature tRNA Score 70.2
HMM Score 43.80
Secondary Structure Score 26.40
Atypical Features None
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTAGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUAGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.139.8-8.853.450.951.850.961.958.627.419.0-3.628.04.8121.0No Hit4.756.750.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (35)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
5 (5′ Acceptor Stem)chr7:128783454rs533242301C / TNoYesGU base pair
6 (5′ Acceptor Stem)chr7:128783455rs569279883G / ANoYesbase pair mismatch
6 (5′ Acceptor Stem)chr7:128783455rs569279883G / TNoYesbase pair mismatch
9 (Acceptor-D-arm-linker)chr7:128783458rs969091697G / CNoNosubstitution in loop
16 (D-loop)chr7:128783465rs1000913179G / CNoNosubstitution in loop
16 (D-loop)chr7:128783465rs1000913179G / TNoNosubstitution in loop
19 (D-loop)chr7:128783467rs566792240G / ANoYesuniversal base change
20 (D-loop)chr7:128783468rs951197778T / GNoNosubstitution in loop
29 (5′ Anticodon Stem)chr7:128783477rs1033265937C / TNoNoGU base pair
30 (5′ Anticodon Stem)chr7:128783478rs534192385G / ANoYesbase pair mismatch
32 (Anticodon Loop)chr7:128783480rs537840732- / TNoNosubstitution in loop
34 (Anticodon Loop)chr7:128783482rs988980274A / CNoNosynonymous anticodon change
34 (Anticodon Loop)chr7:128783482rs988980274A / TNoNosynonymous anticodon change
37 (Anticodon Loop)chr7:128783485rs962338350- / TNoNosubstitution in loop
37 (Anticodon Loop)chr7:128783485rs913385898G / TNoNosubstitution in loop
39 (3′ Anticodon Stem)chr7:128783487rs955486994G / ANoNobase pair mismatch
40 (3′ Anticodon Stem)chr7:128783488rs747667913C / TNoNoGU base pair
41 (3′ Anticodon Stem)chr7:128783489rs911273683G / ANoNobase pair mismatch
47 (Variable Loop)chr7:128783495rs942720413T / CNoNosubstitution in loop
50 (5′ T-arm)chr7:128783498rs147868566C / TNoYesGU base pair
53 (5′ T-arm)chr7:128783501rs778425267G / ANoNobase pair mismatch
53 (5′ T-arm)chr7:128783501rs778425267G / TNoNobase pair mismatch
56 (T-Psi-C Loop)chr7:128783504rs929879469C / TNoNouniversal base change
59 (T-Psi-C Loop)chr7:128783507rs1046954828A / GNoNosubstitution in loop
60 (T-Psi-C Loop)chr7:128783508rs896306768T / CNoNosubstitution in loop
61 (3′ T-arm)chr7:128783509rs1013393706C / TNoNoGU base pair
62 (3′ T-arm)chr7:128783510rs945985306C / TNoNoGU base pair
63 (3′ T-arm)chr7:128783511rs148925636C / TNoYesGU base pair
64 (3′ T-arm)chr7:128783512rs143673298G / ANoYesbase pair mismatch
65 (3′ T-arm)chr7:128783513rs933178900G / ANoNobase pair mismatch
67 (3′ Acceptor Stem)chr7:128783515rs557165040C / TNoYesGU base pair
68 (3′ Acceptor Stem)chr7:128783516rs1050232679- / TNoNorepair bulge
68 (3′ Acceptor Stem)chr7:128783516rs575488059G / ANoYesbase pair mismatch
71 (3′ Acceptor Stem)chr7:128783519rs957669870C / ANoNobase pair mismatch
72 (3′ Acceptor Stem)chr7:128783520rs369414856C / TNoNoGU base pair