Gene: tRNA-Pro-TGG-3-3

Overview
Organism Homo sapiens
Locus chr16:3158922-3158993 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Pro-TGG-3-3
HGNC Symbol TRP-TGG3-3
RNAcentral ID URS00002D40C8_9606
tRNAscan-SE ID chr16.trna4
GtRNAdb 2009
Legacy Name and Score
chr16.trna3-ProTGG (76.15 bits)
Predicted tRNA Isotype / Anticodon Pro TGG
Top Scoring / Second Best Scoring Isotype Model Pro (121.0 bits) / Ala (67.1 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 5
Upstream / Downstream Sequence CAGAGAACGTTTGTCGTCCT / GCTTTTTTTTTTTTTTCTGA
Intron None
Possible Pseudogene No
Gene Score 70.3
Mature tRNA Score 70.3
HMM Score 43.90
Secondary Structure Score 26.40
Atypical Features None
Sequence
Genomic Sequence
GGCTCGTTGGTCTAGGGGTATGATTCTCGCTTTGGGTGCGAGAGGtCCCGGGTTCAAATCCCGGACGAGCCC
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUUGGGUGCGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCC
Alignments
Pro tRNAs
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGATGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-1-1 Sc: 71.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-4 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-5 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-6 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-7 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-AGG-2-8 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTAGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9990_AGG_HUMAN_CY >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-1 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-2 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-1-3 Sc: 70.2 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTCGGGTGTGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-CGG-2-1 Sc: 65.9 >>>>>>>..>>>..........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GGCTCGTTGGTCTAGTGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-1-1 Sc: 74.9 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGGTTTGGGTCCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-2-1 Sc: 70.5 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-1 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-2 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-3 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-4 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC tRNA-Pro-TGG-3-5 Sc: 70.3 GGCTCGTTGGTCTAGGGGTA.TGATTCTCGCTTTGGGTGCGAGAG...........GtCCCGGGTTCAAATCCCGGACGAGCCC DP9991_TGG_HUMAN_CY
>>>>>>>..>>>............<<<.>.>>.>.......................<.<<.<..>.>.........<.<...>>>>>.......<<<<<.<<<<<<<. GGCTCGTTGGTCTAGGGGT.G..TGGTTC.TCGCTTAGGGaccacagggacaagccCGGGA.GA.CCCA.......AGAGGtCCCGGGTTCAAATCCCGG.ACGAGCCC tRNA-Pro-AGG-3-1 Sc: 36.6 (filtered) best isotype model: Pro Sc: 93.8 >>>>..>..>>>............<<<...>..>.......................<..<......................>>>>>.......<<<<<.<..<<<<. GGCTGGTTGGTCTAG.GGCtA..TGATTC.TCACTTAGGG................TGCAA.AAG...............GtCCTGGGTTCAAATCCCAG.AGGAGCCC tRNA-Pro-AGG-4-1 Sc: 28.9 (filtered) best isotype model: Pro Sc: 69.5 >>>.>.>..>>>............<<<.>.>>>>.......................<<<<.<....................>..>>.......<<..<.<.<.<<<. GGCCTGTTGGTCTAGAGGT.A..TGATTC.TCGCTTTGGG................TGCGA.GAG...............G.CCCCGGTGCGAGTCCCAG.AGGAGCCC tRNA-Pro-TGG-4-1 Sc: 27.6 (filtered) best isotype model: Pro Sc: 65.4 >>>>>.>..>.>............<.<.>.>>>.........................<<<.<....................>>>>>.......<<<<<.<.<<<<<. AGCAGTGTGGGCCAGTGGG.A..AG.TGCtCAGGCTTTGG................GGCTGgGAG...............GaTCTGGGTTTGAATCCCAG.CTCTGCTG tRX-Pro-NNN-2-1 Sc: 20.7 (filtered) best isotype model: Pro Sc: 13.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
67.139.8-8.853.550.951.850.961.958.627.419.0-3.928.04.7121.0No Hit4.756.650.329.560.9No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-12.6No HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (75)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
1 (5′ Acceptor Stem)chr16:3158922rs935038129G / ANoNobase pair mismatch
2 (5′ Acceptor Stem)chr16:3158923rs1045925161G / ANoNobase pair mismatch
2 (5′ Acceptor Stem)chr16:3158923rs1045925161G / CNoNobase pair mismatch
3 (5′ Acceptor Stem)chr16:3158924rs906070775C / TNoNoGU base pair
4 (5′ Acceptor Stem)chr16:3158925rs1039823441T / GNoNobase pair mismatch
6 (5′ Acceptor Stem)chr16:3158927rs555861995G / CNoYesbase pair mismatch
6 (5′ Acceptor Stem)chr16:3158927rs555861995G / TNoYesbase pair mismatch
7 (5′ Acceptor Stem)chr16:3158928rs998412003T / GNoNobase pair mismatch
8 (Acceptor-D-arm-linker)chr16:3158929rs1030359432T / GNoNouniversal base change
11 (5′ D-arm)chr16:3158932rs575772761T / ANoYesbase pair mismatch
11 (5′ D-arm)chr16:3158932rs575772761T / CNoYesbase pair mismatch
11 (5′ D-arm)chr16:3158932rs575772761T / GNoYesbase pair mismatch
12 (5′ D-arm)chr16:3158933rs544636728C / GNoYesbase pair mismatch
12 (5′ D-arm)chr16:3158933rs544636728C / TNoYesGU base pair
13 (5′ D-arm)chr16:3158934rs564434880T / CNoYesbase pair mismatch
13 (5′ D-arm)chr16:3158934rs564434880T / GNoYesGU base pair
14 (D-loop)chr16:3158935rs368564781A / GNoYesuniversal base change
16 (D-loop)chr16:3158937rs546169844G / ANoYessubstitution in loop
16 (D-loop)chr16:3158937rs546169844G / TNoYessubstitution in loop
18 (D-loop)chr16:3158938rs553500770G / ANoYesuniversal base change
19 (D-loop)chr16:3158939rs997593344G / ANoNouniversal base change
20 (D-loop)chr16:3158940rs528323079T / ANoYessubstitution in loop
21 (D-loop)chr16:3158941rs142100057A / GNoYesuniversal base change
23 (3′ D-arm)chr16:3158943rs953265766G / TNoNobase pair mismatch
24 (3′ D-arm)chr16:3158944rs979687178A / CNoNobase pair mismatch
24 (3′ D-arm)chr16:3158944rs979687178A / GNoNoGU base pair
24 (3′ D-arm)chr16:3158944rs979687178A / TNoNobase pair mismatch
25 (3′ D-arm)chr16:3158945rs561844823T / GNoYesbase pair mismatch
29 (5′ Anticodon Stem)chr16:3158949rs956836780C / ANoNobase pair mismatch
29 (5′ Anticodon Stem)chr16:3158949rs956836780C / GNoNobase pair mismatch
30 (5′ Anticodon Stem)chr16:3158950rs987772558G / ANoNobase pair mismatch
30 (5′ Anticodon Stem)chr16:3158950rs987772558G / CNoNobase pair mismatch
31 (5′ Anticodon Stem)chr16:3158951rs530477669C / GNoYesbase pair mismatch
32 (Anticodon Loop)chr16:3158952rs917624159T / CNoNosubstitution in loop
34 (Anticodon Loop)chr16:3158954rs949113704T / GNoNosynonymous anticodon change
35 (Anticodon Loop)chr16:3158955rs980540892G / CNoNonon synonymous anticodon change
37 (Anticodon Loop)chr16:3158957rs914926191- / TNoNosubstitution in loop
38 (Anticodon Loop)chr16:3158958rs927442166T / GNoNosubstitution in loop
39 (3′ Anticodon Stem)chr16:3158959rs937498050G / CNoNobase pair mismatch
40 (3′ Anticodon Stem)chr16:3158960rs550170016C / TNoYesGU base pair
41 (3′ Anticodon Stem)chr16:3158961rs570152419G / ANoYesbase pair mismatch
41 (3′ Anticodon Stem)chr16:3158961rs570152419G / CNoYesbase pair mismatch
42 (3′ Anticodon Stem)chr16:3158962rs756797067- / TNoNorepair bulge
43 (3′ Anticodon Stem)chr16:3158963rs940979202G / ANoNobase pair mismatch
45 (Variable Loop)chr16:3158965rs1036316104G / ANoNosubstitution in loop
45 (Variable Loop)chr16:3158965rs1036316104G / CNoNosubstitution in loop
47 (Variable Loop)chr16:3158967rs901873048T / CNoNosubstitution in loop
47 (Variable Loop)chr16:3158967rs901873048T / GNoNosubstitution in loop
48 (Variable Loop)chr16:3158968rs997542441C / GNoNosubstitution in loop
48 (Variable Loop)chr16:3158968rs997542441C / TNoNosubstitution in loop
50 (5′ T-arm)chr16:3158970rs770515683C / TNoNoGU base pair
51 (5′ T-arm)chr16:3158971rs889217547G / ANoNobase pair mismatch
51 (5′ T-arm)chr16:3158971rs889217547G / CNoNobase pair mismatch
53 (5′ T-arm)chr16:3158973rs867735582G / ANoNobase pair mismatch
54 (T-Psi-C Loop)chr16:3158974rs898508211T / CNoNouniversal base change
56 (T-Psi-C Loop)chr16:3158976rs1013000633C / GNoNouniversal base change
58 (T-Psi-C Loop)chr16:3158978rs1000664534A / TNoNouniversal base change
59 (T-Psi-C Loop)chr16:3158979rs1032597880A / GNoNosubstitution in loop
59 (T-Psi-C Loop)chr16:3158979rs1032597880A / TNoNosubstitution in loop
60 (T-Psi-C Loop)chr16:3158980rs1034874408T / CNoNosubstitution in loop
62 (3′ T-arm)chr16:3158982rs868260540C / GNoNobase pair mismatch
62 (3′ T-arm)chr16:3158982rs868260540C / TNoNoGU base pair
63 (3′ T-arm)chr16:3158983rs956641954C / TNoNoGU base pair
64 (3′ T-arm)chr16:3158984rs988021182G / -NoNobulge in stem
64 (3′ T-arm)chr16:3158984rs539044007G / ANoYesbase pair mismatch
64 (3′ T-arm)chr16:3158984rs539044007G / CNoYesbase pair mismatch
65 (3′ T-arm)chr16:3158985rs547299709G / ANoYesbase pair mismatch
65 (3′ T-arm)chr16:3158985rs547299709G / CNoYesbase pair mismatch
67 (3′ Acceptor Stem)chr16:3158987rs372301322C / GNoYesbase pair mismatch
67 (3′ Acceptor Stem)chr16:3158987rs372301322C / TNoYesGU base pair
68 (3′ Acceptor Stem)chr16:3158988rs866199579G / ANoNobase pair mismatch
69 (3′ Acceptor Stem)chr16:3158989rs759411212A / GNoNoGU base pair
71 (3′ Acceptor Stem)chr16:3158991rs200751058- / CNoYesrepair bulge
71 (3′ Acceptor Stem)chr16:3158991rs908713896C / TNoNoGU base pair
72 (3′ Acceptor Stem)chr16:3158992rs940222256C / GNoNobase pair mismatch