Gene: tRNA-Thr-CGT-4-1

Overview
Organism Homo sapiens
Locus chr17:31550074-31550145 (+) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Thr-CGT-4-1
HGNC Symbol TRT-CGT4-1
RNAcentral ID URS00002D4542_9606
tRNAscan-SE ID chr17.trna12
GtRNAdb 2009
Legacy Name and Score
chr17.trna14-ThrCGT (79.77 bits)
Predicted tRNA Isotype / Anticodon Thr CGT
Top Scoring / Second Best Scoring Isotype Model Thr (93.8 bits) / Arg (80.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 4 out of 6
Upstream / Downstream Sequence CACCGGTCCCTGGGCTGTCA / GAGACCCGAGGTAGGGCTTT
Intron None
Possible Pseudogene No
Gene Score 78.3
Mature tRNA Score 78.3
HMM Score 58.20
Secondary Structure Score 20.10
Atypical Features None
Sequence
Genomic Sequence
GGCGCGGTGGCCAAGTGGTAAGGCGTCGGTCTCGTAAACCGAAGAtCGCGGGTTCGAACCCCGTCCGTGCCT
Secondary Structure (nested bp)
>>>>>>>..>>>.........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GGCGCGGUGGCCAAGUGGUAAGGCGUCGGUCUCGUAAACCGAAGAUCGCGGGUUCGAACCCCGUCCGUGCCU
Alignments
Thr tRNAs
>>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-1 Sc: 82.6 GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-2 Sc: 82.6 GGCGCCGTGGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-1-3 Sc: 82.6 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-2-1 Sc: 81.4 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-2-2 Sc: 81.4 GGCTTCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGAGGCCT tRNA-Thr-AGT-4-1 Sc: 81.2 GGCTCCGTAGCTTAGTTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGACTCCCAG.CGGGGCCT tRNA-Thr-AGT-3-1 Sc: 80.7 GGCCCTGTGGCTTAGCTGGTcA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-AGT-6-1 Sc: 80.6 GGCGCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGTGCCT tRNA-Thr-AGT-5-1 Sc: 80.1 GGCTCCGTGGCTTAGCTGGTtA.AAGCGCCTGTCTAGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT DT9992_AGT_HUMAN_CY >>>>>>>..>>>............<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCGGTGGCCAAGT.GGT.A.AGGCGTCGGTCTCGTAAACC.GAAG...........AtCACGGGTTCGAACCCCGT.CCGTGCCT tRNA-Thr-CGT-2-1 Sc: 79.6 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCTATGGCTTAGTTGGTtA.AAGCGCCTGTCTCGTAAACA.GGAG...........AtCCTGGGTTCGACTCCCAG.TGGGGCCT tRNA-Thr-CGT-1-1 Sc: 78.4 >>>>>>>..>>>............<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCGCGGTGGCCAAGT.GGT.A.AGGCGTCGGTCTCGTAAACC.GAAG...........AtCGCGGGTTCGAACCCCGT.CCGTGCCT tRNA-Thr-CGT-4-1 Sc: 78.3 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCTGTGGCTTAGTTGGCtA.AAGCGCCTGTCTCGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.CGGGGCCT tRNA-Thr-CGT-3-1 Sc: 77.1 GGCCCTGTAGCTCAGC.GGTtG.GAGCGCTGGTCTCGTAAACCtAGGG...........GtCGTGAGTTCAAATCTCAC.CAGGGCCT tRNA-Thr-CGT-5-1 Sc: 66.2 >>>>>>>..>>>>..........<<<<.>>>>>.......<<<.<<................>>>>>.......<<<<<.<<<<<<<. GGCTCCATAGCTCAGT.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCGATCCTCGC.TGGGGCCT tRNA-Thr-TGT-2-1 Sc: 84.1 GGCTCTATGGCTTAGTTGGTtA.AAGCGCCTGTCTTGTAAACA.GGAG...........AtCCTGGGTTCGAATCCCAG.TAGAGCCT tRNA-Thr-TGT-1-1 Sc: 83.3 GGCTCCATAGCTCAGG.GGTtA.GAGCGCTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAATTCTCGC.TGGGGCCT tRNA-Thr-TGT-3-1 Sc: 80.0 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-4-1 Sc: 78.8 GGCCCTATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-5-1 Sc: 78.0 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGG............GtCGCGAGTTCAAATCTCGC.TGGGGCCT tRNA-Thr-TGT-6-1 Sc: 75.7 GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAATTCTCGC.TGGGGCTT DT9990_TGT_HUMAN_CY GGCTCCATAGCTCAGG.GGTtA.GAGCACTGGTCTTGTAAACC.AGGG...........GtCGCGAGTTCAAATCTCGC.TGGGGCCT DT9991_TGT_HUMAN_CY
.>>>>>>..>>>>.................<<<<.>>>>>.........<<<<<.................>>............<<....<<<<<<.. AGCACCATGGCTTAGC....TGGTtA....AAGCACCTGTCTAGTA..AACAGGAG...........AtCCTGAGtTTCAATT.CCA..A.TGGTGCCT tRNA-Thr-AGT-7-1 Sc: 44.3 (filtered) best isotype model: Thr Sc: 59.9 >>>>>>>..>>>>.................<<<<.>>>>>.........<<<<<................>>>>..........<<<..<.<<<<<<<. GGCTCTGTGGCTTTGT....GGGTtA....AAGTACTTGTCTGGCA..AACAGGAG...........AtGCTGGAtTTCAATC.CCA..G.CAGGGCCT tRX-Ala-NNN-3-1 Sc: 37.8 (filtered) best isotype model: Thr Sc: 50.2 >>>>>>>..>>>>.................<<<<...>>...........<<..................>>>>>........<<<<..<.<<<<<<<. GGCAGTGTGGCATAGT.....GGTtAgaa.ATGTGC.GCTCTGGGG..CTGC..TG...........AtCCCAGG.CTCAAACCCTG..G.CGCTGTCA tRNA-Pro-GGG-1-1 Sc: 25.9 (filtered) best isotype model: Thr Sc: 20.6 >>>>>.>..>>.>.................<.<<.>>>.>.........<.<<<..................>>>........<<<.....<.<<<<<. GTGTGTATAGCACAGTgcagTGGT.A....GAGCACTTGCTTCTAAgaCGAAAGA............A.CCTGAG.TTCAAGTCTCTacT.TTCACACT tRX-Und-NNN-6-1 Sc: 20.5 (filtered) best isotype model: Thr Sc: 18.1
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
49.680.465.329.462.259.517.536.763.269.246.432.957.629.736.7No Hit56.993.878.356.961.60.1
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo Hit-13.2No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit-12.1No Hit

Top score2nd highest score3rd highest score
DNA Variants (11)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
29 (5′ Anticodon Stem)chr17:31550101rs931084355G / ANoNobase pair mismatch
39 (3′ Anticodon Stem)chr17:31550111rs866187366A / GNoNoGU base pair
41 (3′ Anticodon Stem)chr17:31550113rs1048135977C / TNoNoGU base pair
42 (3′ Anticodon Stem)chr17:31550114rs910924784G / CNoNobase pair mismatch
44 (Variable Loop)chr17:31550116rs557247687A / TNoYessubstitution in loop
47 (Variable Loop)chr17:31550119rs942328844T / CNoNosubstitution in loop
50 (5′ T-arm)chr17:31550122rs575764901C / TNoYesGU base pair
56 (T-Psi-C Loop)chr17:31550128rs981393150C / TNoNouniversal base change
63 (3′ T-arm)chr17:31550135rs1040947422C / TNoNoGU base pair
64 (3′ T-arm)chr17:31550136rs542767513G / ANoYesbase pair mismatch
66 (3′ Acceptor Stem)chr17:31550138rs919143685C / TNoNoGU base pair