Gene: tRNA-Trp-CCA-3-1

Overview
Organism Homo sapiens
Locus chr6:26319102-26319173 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Trp-CCA-3-1
HGNC Symbol TRW-CCA3-1
RNAcentral ID URS0000222FD2_9606
tRNAscan-SE ID chr6.trna183
GtRNAdb 2009
Legacy Name and Score
chr6.trna170-TrpCCA (74.00 bits)
Predicted tRNA Isotype / Anticodon Trp CCA
Top Scoring / Second Best Scoring Isotype Model Trp (106.9 bits) / Arg (80.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 5
Upstream / Downstream Sequence GGAAAATGGAGGGTCTCCGT / TGGGTGGTTGCGTTTTGGAA
Intron None
Possible Pseudogene No
Gene Score 73.3
Mature tRNA Score 73.3
HMM Score 50.60
Secondary Structure Score 22.70
Atypical Features None
Sequence
Genomic Sequence
GACCTCGTGGCGCAACGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCAAATCACGTCGGGGTCA
Secondary Structure (nested bp)
>>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA
Alignments
Trp tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GACCTCGTGGCGCAATGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAGTCACGTCGGGGTCA tRNA-Trp-CCA-2-1 Sc: 75.1 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GcTGCGTGTTCGAATCACGTCGGGGTCA tRNA-Trp-CCA-4-1 Sc: 74.3 GGCCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-1-1 Sc: 73.4 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-1 Sc: 73.3 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-2 Sc: 73.3 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-3 Sc: 73.3 GACCTCGTGGCGCAACGGCA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-5-1 Sc: 68.8
>>>>>>...>>>>........<<<<.>>>>>.......<<<<<................>>.>>.......<<.<<.<<<<<<. GGCCTCATGGTGCAACAGTA.GTGTGTCTGACTCCAGATCAGAAG...........GtTGTATGTTCAAATCACGTAGGGGTCA tRX-Trp-NNN-1-1 Sc: 30.6 (filtered) best isotype model: Trp Sc: 53.9
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
41.980.457.7No Hit66.533.8No Hit39.955.763.120.844.449.432.830.2No Hit22.068.3106.951.438.9-9.4
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (35)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
3 (5′ Acceptor Stem)chr6:26319171rs758701670C / TNoNoGU base pair
3 (5′ Acceptor Stem)chr6:26319171rs758701670C / GNoNobase pair mismatch
4 (5′ Acceptor Stem)chr6:26319170rs950290983C / GNoNobase pair mismatch
6 (5′ Acceptor Stem)chr6:26319168rs750810921C / TNoNoGU base pair
10 (5′ D-arm)chr6:26319164rs1048419801G / CNoNobase pair mismatch
11 (5′ D-arm)chr6:26319163rs558308326C / TNoYesGU base pair
12 (5′ D-arm)chr6:26319162rs184968699G / ANoYesbase pair mismatch
13 (5′ D-arm)chr6:26319161rs139849531C / TNoYesGU base pair
14 (D-loop)chr6:26319160rs1037298301A / GNoNouniversal base change
16 (D-loop)chr6:26319158rs910651904C / ANoNosubstitution in loop
18 (D-loop)chr6:26319157rs150667161G / ANoYesuniversal base change
20 (D-loop)chr6:26319155rs985298952T / GNoNosubstitution in loop
21 (D-loop)chr6:26319154rs955356391A / GNoNouniversal base change
26 (D-arm-Anticodon-linker)chr6:26319149rs1005384856G / TNoNosubstitution in loop
26 (D-arm-Anticodon-linker)chr6:26319149rs1005384856G / ANoNosubstitution in loop
34 (Anticodon Loop)chr6:26319141rs955989918C / GNoNonon synonymous anticodon change
37 (Anticodon Loop)chr6:26319138rs376929387G / CNoNosubstitution in loop
37 (Anticodon Loop)chr6:26319138rs376929387G / ANoNosubstitution in loop
38 (Anticodon Loop)chr6:26319137rs999841812A / GNoNosubstitution in loop
39 (3′ Anticodon Stem)chr6:26319136rs536472523T / GNoYesbase pair mismatch
39 (3′ Anticodon Stem)chr6:26319136rs536472523T / ANoYesbase pair mismatch
40 (3′ Anticodon Stem)chr6:26319135rs1023106223C / GNoNobase pair mismatch
42 (3′ Anticodon Stem)chr6:26319133rs887898312G / ANoNobase pair mismatch
46 (Variable Loop)chr6:26319129rs141977360G / ANoYessubstitution in loop
49 (5′ T-arm)chr6:26319126rs932029530G / ANoNorestore Watson-Crick base pair
50 (5′ T-arm)chr6:26319125rs548687262C / TNoYesGU base pair
51 (5′ T-arm)chr6:26319124rs1047935371G / ANoNobase pair mismatch
56 (T-Psi-C Loop)chr6:26319119rs929538612C / TNoNouniversal base change
61 (3′ T-arm)chr6:26319114rs796643078C / GNoNobase pair mismatch
63 (3′ T-arm)chr6:26319112rs571007388C / TNoYesGU base pair
65 (3′ T-arm)chr6:26319110rs761822313T / GNoNobase pair mismatch
66 (3′ Acceptor Stem)chr6:26319109rs182578162C / TNoYesGU base pair
67 (3′ Acceptor Stem)chr6:26319108rs552294100G / CNoYesbase pair mismatch
70 (3′ Acceptor Stem)chr6:26319105rs1052260028- / GNoNorepair bulge
70 (3′ Acceptor Stem)chr6:26319105rs910567636G / -NoNobulge in stem