Gene: tRNA-Trp-CCA-3-2

Overview
Organism Homo sapiens
Locus chr6:26331444-26331515 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Trp-CCA-3-2
HGNC Symbol TRW-CCA3-2
RNAcentral ID URS0000222FD2_9606
tRNAscan-SE ID chr6.trna181
GtRNAdb 2009
Legacy Name and Score
chr6.trna168-TrpCCA (74.00 bits)
Predicted tRNA Isotype / Anticodon Trp CCA
Top Scoring / Second Best Scoring Isotype Model Trp (106.9 bits) / Arg (80.4 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 5
Upstream / Downstream Sequence TAAAACGTAGGTGTCCCGGA / ACAGTTTTTAGCTCGCTGGC
Intron None
Possible Pseudogene No
Gene Score 73.3
Mature tRNA Score 73.3
HMM Score 50.60
Secondary Structure Score 22.70
Atypical Features None
Sequence
Genomic Sequence
GACCTCGTGGCGCAACGGTAGCGCGTCTGACTCCAGATCAGAAGGtTGCGTGTTCAAATCACGTCGGGGTCA
Secondary Structure (nested bp)
>>>>>>>..>>>>.......<<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGUUGCGUGUUCAAAUCACGUCGGGGUCA
Alignments
Trp tRNAs
>>>>>>>..>>>>........<<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<. GACCTCGTGGCGCAATGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAGTCACGTCGGGGTCA tRNA-Trp-CCA-2-1 Sc: 75.1 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GcTGCGTGTTCGAATCACGTCGGGGTCA tRNA-Trp-CCA-4-1 Sc: 74.3 GGCCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-1-1 Sc: 73.4 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-1 Sc: 73.3 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-2 Sc: 73.3 GACCTCGTGGCGCAACGGTA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-3-3 Sc: 73.3 GACCTCGTGGCGCAACGGCA.GCGCGTCTGACTCCAGATCAGAAG...........GtTGCGTGTTCAAATCACGTCGGGGTCA tRNA-Trp-CCA-5-1 Sc: 68.8
>>>>>>...>>>>........<<<<.>>>>>.......<<<<<................>>.>>.......<<.<<.<<<<<<. GGCCTCATGGTGCAACAGTA.GTGTGTCTGACTCCAGATCAGAAG...........GtTGTATGTTCAAATCACGTAGGGGTCA tRX-Trp-NNN-1-1 Sc: 30.6 (filtered) best isotype model: Trp Sc: 53.9
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
41.980.457.7No Hit66.533.8No Hit39.955.763.120.844.449.432.830.2No Hit22.068.3106.951.438.9-9.4
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (29)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
2 (5′ Acceptor Stem)chr6:26331514rs1032471543A / CNoNobase pair mismatch
3 (5′ Acceptor Stem)chr6:26331513rs550220763C / GNoYesbase pair mismatch
6 (5′ Acceptor Stem)chr6:26331510rs1017103204C / TNoNoGU base pair
7 (5′ Acceptor Stem)chr6:26331509rs1005666213G / ANoNobase pair mismatch
8 (Acceptor-D-arm-linker)chr6:26331508rs765301911T / GNoNouniversal base change
11 (5′ D-arm)chr6:26331505rs763792266C / GNoNobase pair mismatch
11 (5′ D-arm)chr6:26331505rs763792266C / ANoNobase pair mismatch
28 (5′ Anticodon Stem)chr6:26331489rs533697674C / ANoYesbase pair mismatch
29 (5′ Anticodon Stem)chr6:26331488rs1013441808T / CNoNobase pair mismatch
30 (5′ Anticodon Stem)chr6:26331487rs188365547G / ANoYesbase pair mismatch
31 (5′ Anticodon Stem)chr6:26331486rs1046900954A / GNoNoGU base pair
37 (Anticodon Loop)chr6:26331480rs548052782G / CNoYessubstitution in loop
37 (Anticodon Loop)chr6:26331480rs548052782G / ANoYessubstitution in loop
38 (Anticodon Loop)chr6:26331479rs759229026A / TNoNosubstitution in loop
38 (Anticodon Loop)chr6:26331479rs759229026A / GNoNosubstitution in loop
41 (3′ Anticodon Stem)chr6:26331476rs1038184803A / TNoNobase pair mismatch
42 (3′ Anticodon Stem)chr6:26331475rs769648211G / ANoNobase pair mismatch
45 (Variable Loop)chr6:26331472rs527382469G / ANoYessubstitution in loop
49 (5′ T-arm)chr6:26331468rs561632678G / ANoYesrestore Watson-Crick base pair
50 (5′ T-arm)chr6:26331467rs942083644C / ANoNobase pair mismatch
51 (5′ T-arm)chr6:26331466rs183670263G / TNoYesbase pair mismatch
51 (5′ T-arm)chr6:26331466rs183670263G / ANoYesbase pair mismatch
57 (T-Psi-C Loop)chr6:26331460rs560762895A / GNoYessubstitution in loop
63 (3′ T-arm)chr6:26331454rs138300590C / TNoYesGU base pair
63 (3′ T-arm)chr6:26331454rs138300590C / GNoYesbase pair mismatch
67 (3′ Acceptor Stem)chr6:26331450rs747346737G / ANoNobase pair mismatch
68 (3′ Acceptor Stem)chr6:26331449rs923477872G / CNoNobase pair mismatch
70 (3′ Acceptor Stem)chr6:26331447rs972393352G / ANoNobase pair mismatch
72 (3′ Acceptor Stem)chr6:26331445rs988334362C / ANoNobase pair mismatch