Gene: tRNA-Val-CAC-3-1

Overview
Organism Homo sapiens
Locus chr19:4724635-4724707 (-) View in Genome Browser
GtRNAdb Gene Symbol tRNA-Val-CAC-3-1
HGNC Symbol TRV-CAC3-1
RNAcentral ID URS00002B4CE5_9606
tRNAscan-SE ID chr19.trna11
GtRNAdb 2009
Legacy Name and Score
chr19.trna13-ValCAC (84.20 bits)
Predicted tRNA Isotype / Anticodon Val CAC
Top Scoring / Second Best Scoring Isotype Model Val (112.4 bits) / Thr (75.7 bits)
Predicted Anticodon and Top Isotype Model Consistent
Rank of tRNA Isodecoder 3 out of 14
Upstream / Downstream Sequence AAGAACCCTGACGCCTACCG / GGTCAGCTGTTTTTCCTAAC
Intron None
Possible Pseudogene No
Gene Score 79.2
Mature tRNA Score 79.2
HMM Score 49.10
Secondary Structure Score 30.10
Atypical Features None
Sequence
Genomic Sequence
GTTTCCGTAGTGTAGCGGTtATCACATTCGCCTCACACGCGAAAGGtCCCCGGTTCGATCCCGGGCGGAAACA
Secondary Structure (nested bp)
>>>>>>>..>>>..........<<<.>>>>>.......<<<<<.....>>>>>.......<<<<<<<<<<<<.
Predicted Mature tRNA
GUUUCCGUAGUGUAGCGGUUAUCACAUUCGCCUCACACGCGAAAGGUCCCCGGUUCGAUCCCGGGCGGAAACA
Alignments
Val tRNAs
>>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-1-1 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-1-2 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-1-3 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-1-4 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-1-5 Sc: 79.4 GTTTCCGTAGTGTAGTGGTcA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-2-1 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCTGGATCAAAACCAGGCGGAAACA... tRNA-Val-AAC-3-1 Sc: 72.8 >>>>>>>..>>>>.........<<<<.>>>>.........<<<<................>>>>>.......<<<<<<<<<<<<.... GGGGGTGTAGCTCAGTGGT.A.GAGCGTATGCTTAACATTCATGAG...........GcTCTGGGTTCGATCCCCAGCACTTCCA... tRNA-Val-AAC-6-1 Sc: 69.9 >>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>.>>>.......<<<.<<<<<<<<.... GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCGCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-AAC-4-1 Sc: 69.2 >>>>>.>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<.<<<<<.... GTTTCCGTAGTGTAGTGGTtA.TCACGTTTGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCAGAAACA... tRNA-Val-AAC-5-1 Sc: 67.0 >>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... DV9990_AAC_HUMAN_CY GTTTCCGTAGTGTAGTGGTcA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... DV9992_AAC_HUMAN_CY GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCTGGATCAAAACCAGGCGGAAACA... DV9993_AAC_HUMAN_CY GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTAACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... DV9996_AAC_HUMAN_CY >>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GCTTCTGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCAGAAGCA... tRNA-Val-CAC-2-1 Sc: 80.5 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-1 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-2 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-3 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-4 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-5 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-6 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-1-7 Sc: 79.4 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... tRNA-Val-CAC-5-1 Sc: 79.4 GTTTCCGTAGTGTAGCGGTtA.TCACATTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGATCCCGGGCGGAAACA... tRNA-Val-CAC-3-1 Sc: 79.2 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACTGGGCGGAAACA... tRNA-Val-CAC-4-1 Sc: 72.2 >>>>>>>..>>>>.........<<<<.>>>>>.......<<<<<................>>.>>.......<<.<<<<<<<<<.... GTTTCCGTAGTGGAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTTGAAACCAGGCGGAAACA... tRNA-Val-CAC-6-1 Sc: 63.1 >>>>>>>..>>>...........<<<.>>>>>.......<<<<<.................>>>>.......<<<<.<<<<<<<.... GTTTCCGTAGTGTAGTGGTtA.TCATGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACTGGATGGAAACA... tRNA-Val-CAC-14-1 Sc: 59.3 >>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACA... DV9991_CAC_HUMAN_CY GCTTCTGTAGTGTAGTGGTtA.TCACGTTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCAGAAGCA... DV9994_CAC_HUMAN_CY GTTTCCGTAGTGTAGCGGTtA.TCACATTCGCCTCACACGCGAAAG...........GtCCCCGGTTCGATCCCGGGCGGAAACA... DV9995_CAC_HUMAN_CY >>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... GGTTCCATAGTGTAGTGGTtA.TCACGTCTGCTTTACACGCAGAAG...........GtCCTGGGTTCGAGCCCCAGTGGAACCA... tRNA-Val-TAC-1-1 Sc: 82.9 GGTTCCATAGTGTAGTGGTtA.TCACGTCTGCTTTACACGCAGAAG...........GtCCTGGGTTCGAGCCCCAGTGGAACCA... tRNA-Val-TAC-1-2 Sc: 82.9 GGTTCCATAGTGTAGTGGTtA.TCACATCTGCTTTACACGCAGAAG...........GtCCTGGGTTCAAGCCCCAGTGGAACCA... tRNA-Val-TAC-3-1 Sc: 80.7 GGTTCCATAGTGTAGCGGTtA.TCACGTCTGCTTTACACGCAGAAG...........GtCCTGGGTTCGAGCCCCAGTGGAACCA... tRNA-Val-TAC-2-1 Sc: 80.5 GTTTCCGTGGTGTAGTGGTtA.TCACATTCGCCTTACACGCGAAAG...........GtCCTCGGGTCGAAACCGAGCGGAAACA... tRNA-Val-TAC-4-1 Sc: 68.7 GTTTCCGTAGTGTAGTGGTtA.TCACGTTCGCCTNACACGCGAAAG...........GtCCCCGGTTCGAAACCGGGCGGAAACAcca RV9990_NAC_HUMAN_PLACENTA >>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>>>>.......<<<<<<<<<<<<.... RV9990_NAC_HUMAN_PLACENTA
>>>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>.>>.......<<.<<<<<<<<<. GTTTCCGTAGTGTAGTGGTtA.TTATGTTCGCCTCACACGCGAAAA...........GtCCCCGGTTCGAAATCAGGCGGGAACA tRNA-Val-CAC-7-1 Sc: 49.0 (filtered) best isotype model: Val Sc: 85.4 >>>>>>>..>>.............<<.>>.>>.......<<.<<................>>>>>.......<<<<<<<<<<<<. GTTTCTGTAGTATGGTGGTtA.TCACGTTAGTCTCACACGTGAAAG...........GtCCCTGGTTCGAAACCAGGTGGAAACA tRNA-Val-CAC-9-1 Sc: 43.8 (filtered) best isotype model: Val Sc: 77.0 >>>>>....>>>...........<<<.>>>.>.......<.<<<................>>>>>.......<<<<<..<<<<<. GTTTCCATAGTGTACTGGTtA.TCACATTCACCTAACACGCGAAAG...........GtCCTTGGTTTGAAACCAGGCAGAAACA tRNA-Val-AAC-7-1 Sc: 39.9 (filtered) best isotype model: Val Sc: 75.9 >>>>>>.....>...........<...>>>>>.......<<<<<................>>>>>.......<<<<<.<<<<<<. GTTTCCATAGCGTAGTAATtA.TCAAGTTTGCCTAACACGCGAAAT...........GtCCCCGGTTCAAAACCGGGCGGAAACA tRX-Val-NNN-1-1 Sc: 33.8 (filtered) best isotype model: Val Sc: 71.5 >>>>>>>..>>>...........<<<.>>.>.........<.<<................>>>>>.......<<<<<<<<<<<<. GGTTCCATAGTGTAACAGTtA.TCATGTCTGCTTTACACACTGAAG...........GtCCTGGGTTCAAACTCCAGTGGAACCA tRX-Val-NNN-2-1 Sc: 47.6 (filtered) best isotype model: Val Sc: 70.8 >>>>>>>..>>>...........<<<.>>>.>.......<.<<<................>>>>.........<<<<<<<<<<<. GTTTCTGTGGTGTAGTGGTtA.TCATGTTCGCCTCACACGAGAAAA...........GtCCCTGATTCGAGACTGGGTGGGAACG tRNA-Val-CAC-10-1 Sc: 37.6 (filtered) best isotype model: Val Sc: 66.2 >.>>>>>..>>>...........<<<.>>>>>.......<<<<<................>>..>.......<..<<<<<<<.<. GATTCTATAGTGTAGCAGTtA.TCACATCTGCTTTACATGCAGAAG...........GtCCTAGGTTTGAGCCGCGGTGGAACCA tRX-Val-NNN-3-1 Sc: 32.5 (filtered) best isotype model: Val Sc: 61.0 >>>>>>>..>>>...........<<<.>>>>.........<<<<................>.>>>.......<<<.<<<<<<<<. GTTTCTGTGGTGTAGTGGTtA.TTATGTTCGCTTCACATATGAAAG...........GtCTCTGGTTCGAGACTGCGTGGGAACA tRNA-Val-CAC-11-1 Sc: 27.2 (filtered) best isotype model: Val Sc: 59.2 GTTTCTGTGGTGTAGTGGTtA.TTATGTTCGCTTCACATATGAAAG...........GtCTCTGGTTCGAGACTGCGTGGGAACA tRNA-Val-CAC-11-2 Sc: 27.2 (filtered) best isotype model: Val Sc: 59.2 >>>>>>...>>.............<<.>>>>>.......<<<<<.................>>>>.......<<<<..<<<<<<. GTTTCTGTAGTATAGTGGTtA.TCATGTTTGCCTCACATGTGAAAG...........AcCCTTGGCTCGAGACTGGAGGGAAACA tRNA-Val-CAC-13-1 Sc: 24.9 (filtered) best isotype model: Val Sc: 50.2
Isotype-Specific Model Scores
AlaArgAsnAspCysGlnGluGlyHisIleLeuLysMetPheProSeCSerThrTrpTyrValiMet
68.866.257.959.953.765.459.857.964.353.4No Hit12.658.314.566.3No Hit20.875.747.651.5112.4No Hit
mt-Alamt-Argmt-Asnmt-Aspmt-Cysmt-Glnmt-Glumt-Glymt-Hismt-Ilemt-LeuTAAmt-LeuTAGmt-Lysmt-Metmt-Phemt-Promt-SerGCTmt-SerTGAmt-Thrmt-Trpmt-Tyrmt-Val
No HitNo HitNo HitNo HitNo HitNo Hit-11.9No HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo HitNo Hit

Top score2nd highest score3rd highest score
DNA Variants (79)
tRNA Position Genomic Position dbSNP ID Ref/Alt Allele Common SNP 1K Genome Effect
2 (5′ Acceptor Stem)chr19:4724706rs577124189T / CNoYesbase pair mismatch
7 (5′ Acceptor Stem)chr19:4724701rs182900626G / ANoYesbase pair mismatch
8 (Acceptor-D-arm-linker)chr19:4724700rs985754290T / CNoNouniversal base change
10 (5′ D-arm)chr19:4724698rs140986725G / TNoYesbase pair mismatch
10 (5′ D-arm)chr19:4724698rs140986725G / CNoYesbase pair mismatch
11 (5′ D-arm)chr19:4724697rs540466979T / CNoYesbase pair mismatch
12 (5′ D-arm)chr19:4724696rs574668666G / ANoYesbase pair mismatch
13 (5′ D-arm)chr19:4724695rs772010721T / CNoNobase pair mismatch
14 (D-loop)chr19:4724694rs554235262A / GNoNouniversal base change
15 (D-loop)chr19:4724693rs1051297772G / TNoNosubstitution in loop
15 (D-loop)chr19:4724693rs1051297772G / ANoNosubstitution in loop
16 (D-loop)chr19:4724692rs151073259C / TNoYessubstitution in loop
16 (D-loop)chr19:4724692rs151073259C / GNoYessubstitution in loop
16 (D-loop)chr19:4724692rs151073259C / ANoYessubstitution in loop
18 (D-loop)chr19:4724691rs981578034G / TNoNouniversal base change
18 (D-loop)chr19:4724691rs981578034G / CNoNouniversal base change
18 (D-loop)chr19:4724691rs981578034G / ANoNouniversal base change
21 (D-loop)chr19:4724687rs746033192A / GNoNouniversal base change
21 (D-loop)chr19:4724687rs746033192A / CNoNouniversal base change
23 (3′ D-arm)chr19:4724685rs1023150859C / TNoNoGU base pair
24 (3′ D-arm)chr19:4724684rs536089729A / GNoNoGU base pair
26 (D-arm-Anticodon-linker)chr19:4724682rs558267675A / TNoYessubstitution in loop
26 (D-arm-Anticodon-linker)chr19:4724682rs558267675A / GNoYessubstitution in loop
29 (5′ Anticodon Stem)chr19:4724679rs927168124C / TNoNoGU base pair
29 (5′ Anticodon Stem)chr19:4724679rs927168124C / ANoNobase pair mismatch
30 (5′ Anticodon Stem)chr19:4724678rs1033294452G / TNoNobase pair mismatch
30 (5′ Anticodon Stem)chr19:4724678rs1033294452G / ANoNobase pair mismatch
31 (5′ Anticodon Stem)chr19:4724677rs569772734C / TNoYesGU base pair
32 (Anticodon Loop)chr19:4724676rs902199048C / TNoNosubstitution in loop
34 (Anticodon Loop)chr19:4724674rs1042520856C / TNoNosynonymous anticodon change
35 (Anticodon Loop)chr19:4724673rs1007993198A / CNoNonon synonymous anticodon change
36 (Anticodon Loop)chr19:4724672rs757482566C / TNoNonon synonymous anticodon change
37 (Anticodon Loop)chr19:4724671rs144383244A / GNoYessubstitution in loop
38 (Anticodon Loop)chr19:4724670rs549867898C / TNoNosubstitution in loop
38 (Anticodon Loop)chr19:4724670rs549867898C / GNoNosubstitution in loop
40 (3′ Anticodon Stem)chr19:4724668rs553818105C / TNoYesGU base pair
41 (3′ Anticodon Stem)chr19:4724667rs932536873G / TNoNobase pair mismatch
41 (3′ Anticodon Stem)chr19:4724667rs932536873G / ANoNobase pair mismatch
42 (3′ Anticodon Stem)chr19:4724666rs190563750A / GNoYesGU base pair
43 (3′ Anticodon Stem)chr19:4724665rs756556636A / GNoNoGU base pair
44 (Variable Loop)chr19:4724664rs567372681A / GNoYessubstitution in loop
45 (Variable Loop)chr19:4724663rs571425780G / ANoYessubstitution in loop
46 (Variable Loop)chr19:4724662rs531724193G / TNoYessubstitution in loop
46 (Variable Loop)chr19:4724662rs531724193G / CNoYessubstitution in loop
46 (Variable Loop)chr19:4724662rs531724193G / ANoYessubstitution in loop
47 (Variable Loop)chr19:4724661rs981908977T / GNoNosubstitution in loop
48 (Variable Loop)chr19:4724660rs753226115C / TNoNosubstitution in loop
48 (Variable Loop)chr19:4724660rs753226115C / GNoNosubstitution in loop
48 (Variable Loop)chr19:4724660rs753226115C / ANoNosubstitution in loop
49 (5′ T-arm)chr19:4724659rs186533156C / TNoYesGU base pair
49 (5′ T-arm)chr19:4724659rs186533156C / GNoYesbase pair mismatch
49 (5′ T-arm)chr19:4724659rs186533156C / ANoYesbase pair mismatch
50 (5′ T-arm)chr19:4724658rs182121444C / TNoYesGU base pair
50 (5′ T-arm)chr19:4724658rs182121444C / GNoYesbase pair mismatch
51 (5′ T-arm)chr19:4724657rs949941244C / -NoNobulge in stem
51 (5′ T-arm)chr19:4724657rs531725615C / TNoYesGU base pair
52 (5′ T-arm)chr19:4724656rs548286827- / TNoYesrepair bulge
52 (5′ T-arm)chr19:4724656rs1033240975G / ANoNobase pair mismatch
54 (T-Psi-C Loop)chr19:4724654rs999135322T / CNoNouniversal base change
55 (T-Psi-C Loop)chr19:4724653rs966752081T / CNoNouniversal base change
56 (T-Psi-C Loop)chr19:4724652rs1020639405C / TNoNouniversal base change
57 (T-Psi-C Loop)chr19:4724651rs772802249G / TNoNosubstitution in loop
58 (T-Psi-C Loop)chr19:4724650rs532363429A / GNoYesuniversal base change
59 (T-Psi-C Loop)chr19:4724649rs1008355138T / CNoNosubstitution in loop
61 (3′ T-arm)chr19:4724647rs375199166- / ACNoYesrepair bulge
61 (3′ T-arm)chr19:4724647rs375199166- / ANoYesrepair bulge
61 (3′ T-arm)chr19:4724647rs764927709C / TNoNoGU base pair
61 (3′ T-arm)chr19:4724647rs764927709C / GNoNobase pair mismatch
62 (3′ T-arm)chr19:4724646rs572941498- / TNoYesrepair bulge
62 (3′ T-arm)chr19:4724646rs377616784C / TNoNoGU base pair
62 (3′ T-arm)chr19:4724646rs377616784C / ANoNobase pair mismatch
64 (3′ T-arm)chr19:4724644rs1049501916G / CNoNobase pair mismatch
66 (3′ Acceptor Stem)chr19:4724642rs761437715C / TNoNoGU base pair
66 (3′ Acceptor Stem)chr19:4724642rs761437715C / ANoNobase pair mismatch
67 (3′ Acceptor Stem)chr19:4724641rs909745511G / CNoNobase pair mismatch
68 (3′ Acceptor Stem)chr19:4724640rs898358644G / ANoNobase pair mismatch
71 (3′ Acceptor Stem)chr19:4724637rs189629057A / GNoYesGU base pair
72 (3′ Acceptor Stem)chr19:4724636rs776136696C / TNoNoGU base pair
72 (3′ Acceptor Stem)chr19:4724636rs776136696C / GNoNobase pair mismatch